<110> 	F. Hoffmann-La Roche AG
 
<120>	Compositions and methods for inhibiting expression of Glucocorticoid receptor (GR) genes
 
<130>	26100

<160>	1036 


<210>	1
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 7, 10, 11, 14, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 8, 9, 12, 13, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	1
cauguacgac caauguaaat t	21
 
 
<210>	2
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 7, 8, 11, 12, 14, 16, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 6, 9, 10, 13, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	2
uuuacauugg ucguacaugt t	21
 
 
<210>	3
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 9, 10, 12, 14, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 7, 8, 11, 13, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	3
uugcuuaacu acauauagat t	21
 
 
<210>	4
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 7, 9, 12, 13, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 6, 8, 10, 11, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	4
ucuauaugua guuaagcaat t	21
 
 
<210>	5
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 7, 8, 9, 11, 12, 13, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 10, 14, 15, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	5
aaauaacuug cuuaacuact t	21
 
 
<210>	6
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 10, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 7, 8, 9, 11, 12, 13, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	6
guaguuaagc aaguuauuut t	21
 
 
<210>	7
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 8, 9, 11, 13, 15, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 6, 7, 10, 12, 14, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	7
ugcuuaacua cauauagaut t	21
 
 
<210>	8
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 8, 10, 13, 14, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 7, 9, 11, 12, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	8
aucuauaugu aguuaagcat t	21
 
 
<210>	9
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 10, 11, 12, 13, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 6, 7, 8, 9, 14, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	9
guaugaaaac cuuacugcut t	21
 
 
<210>	10
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 6, 11, 12, 13, 14, 15, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 7, 8, 9, 10, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	10
agcaguaagg uuuucauact t	21
 
 
<210>	11
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 10, 11, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 7, 8, 9, 12, 13, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	11
cagugagagu ugguuacuct t	21
 
 
<210>	12
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 7, 8, 11, 12, 13, 14, 15, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 9, 10, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	12
gaguaaccaa cucucacugt t	21
 
 
<210>	13
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 10, 11, 13, 15, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 8, 9, 12, 14, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	13
ggguggagau cauauagact t	21
 
 
<210>	14
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 6, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	14
gucuauauga ucuccaccct t	21
 
 
<210>	15
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 10, 11, 13, 15, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 8, 9, 12, 14, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	15
ggguggagau cauauagact t	21
 
 
<210>	16
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 8, 11, 12, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 7, 9, 10, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	16
gucuauauga ucuccaccct t	21
 
 
<210>	17
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 10, 11, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 7, 8, 9, 12, 13, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	17
cagugagagu ugguuacuct t	21
 
 
<210>	18
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 8, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	18
gaguaaccaa cucucacugt t	21
 
 
<210>	19
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 9, 12, 13, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 7, 8, 10, 11, 14, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	19
cauauagaca aucaagugct t	21
 
 
<210>	20
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 9, 10, 12, 13, 14, 16, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 7, 8, 11, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	20
gcacuugauu gucuauaugt t	21
 
 
<210>	21
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 7, 9, 11, 13, 14, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 6, 8, 10, 12, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	21
ccuauguaug uguuaucugt t	21
 
 
<210>	22
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 8, 10, 12, 14, 16
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 7, 9, 11, 13, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	22
cagauaacac auacauaggt t	21
 
 
<210>	23
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 8, 10, 11, 12, 13, 15, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 9, 14, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	23
uuaaugucau uccaccaaut t	21
 
 
<210>	24
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 11, 14, 16, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 7, 8, 9, 10, 12, 13, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	24
auugguggaa ugacauuaat t	21
 
 
<210>	25
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 9, 10, 12, 14, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 7, 8, 11, 13, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	25
uugcuuaacu acauauagat t	21
 
 
<210>	26
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 9, 13, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 7, 8, 10, 11, 12, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	26
ucuauaugua guuaagcaat t	21
 
 
<210>	27
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 7, 8, 10, 11
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	27
uggucgaaca guuuuuucut t	21
 
 
<210>	28
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	9, 10, 12, 13, 14, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 11, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	28
agaaaaaacu guucgaccat t	21
 
 
<210>	29
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 7, 8, 11, 12, 13, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 9, 10, 14, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	29
cacacauuaa ucugauuuut t	21
 
 
<210>	30
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 6, 10, 11, 14, 16, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 7, 8, 9, 12, 13, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	30
aaaaucagau uaaugugugt t	21
 
 
<210>	31
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 10, 11, 12, 13, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 6, 7, 8, 9, 14, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	31
guaugaaaac cuuacugcut t	21
 
 
<210>	32
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 6, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	32
agcaguaagg uuuucauact t	21
 
 
<210>	33
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 10, 11, 12, 13, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 7, 8, 9, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	33
cuacaggagu cucacaagat t	21
 
 
<210>	34
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	34
ucuugugaga cuccuguagt t	21
 
 
<210>	35
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 7, 8, 9, 10, 11, 13
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	35
cuguaugaaa auacccucct t	21
 
 
<210>	36
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 13, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	36
ggaggguauu uucauacagt t	21
 
 
<210>	37
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 8, 10, 12, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 7, 9, 11, 13, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	37
uccuauguau guguuaucut t	21
 
 
<210>	38
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 7, 9, 11, 13, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 8, 10, 12, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	38
agauaacaca uacauaggat t	21
 
 
<210>	39
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 9, 10, 12, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 11, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	39
gguggagauc auauagacat t	21
 
 
<210>	40
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 7, 9, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 6, 8, 10, 11, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	40
ugucuauaug aucuccacct t	21
 
 
<210>	41
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 9, 10, 13, 15, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 7, 8, 11, 12, 14, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	41
auguacgacc aauguaaact t	21
 
 
<210>	42
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 8, 9, 12, 13, 15, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 7, 10, 11, 14, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	42
guuuacauug gucguacaut t	21
 
 
<210>	43
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 9, 12, 13, 14, 15, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 7, 8, 10, 11, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	43
acuggcagcg guuuuaucat t	21
 
 
<210>	44
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 9, 10, 12, 13, 15, 16, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 7, 8, 11, 14, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	44
ugauaaaacc gcugccagut t	21
 
 
<210>	45
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 9, 10, 13, 14, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 11, 12, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	45
agugagaguu gguuacucat t	21
 
 
<210>	46
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 8, 9, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 7, 10, 11, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	46
ugaguaacca acucucacut t	21
 
 
<210>	47
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 6, 7, 8, 10, 11, 12, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 9, 13, 14, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	47
aauaacuugc uuaacuacat t	21
 
 
<210>	48
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 7, 11, 15, 16, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 8, 9, 10, 12, 13, 14, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	48
uguaguuaag caaguuauut t	21
 
 
<210>	49
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 8, 9, 12, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 10, 11, 14, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	49
gugagaguug guuacucact t	21
 
 
<210>	50
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 6, 9, 10, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 7, 8, 11, 12, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	50
gugaguaacc aacucucact t	21
 
 
<210>	51
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 7, 10, 15, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 8, 9, 11, 12, 13, 14, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	51
caucaucgau aaaauucgat t	21
 
 
<210>	52
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 7, 8, 9, 11, 12, 15, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 10, 13, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	52
ucgaauuuua ucgaugaugt t	21
 
 
<210>	53
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 7, 8, 9, 10, 11, 13
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	53
cuguaugaaa auacccucct t	21
 
 
<210>	54
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 9, 10, 11, 12, 13, 15, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	54
ggaggguauu uucauacagt t	21
 
 
<210>	55
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 7, 8, 10, 11
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	55
uggucgaaca guuuuuucut t	21
 
 
<210>	56
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	56
agaaaaaacu guucgaccat t	21
 
 
<210>	57
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 8, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	57
acgauucauu ccuuuuggat t	21
 
 
<210>	58
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 12, 16, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	58
uccaaaagga augaaucgut t	21
 
 
<210>	59
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 12, 13, 14, 15, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 7, 8, 9, 10, 11, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	59
cuguaugaaa accuuacugt t	21
 
 
<210>	60
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 13, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	60
caguaagguu uucauacagt t	21
 
 
<210>	61
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 8, 9, 12, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 10, 11, 14, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	61
gugagaguug guuacucact t	21
 
 
<210>	62
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 10, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	62
gugaguaacc aacucucact t	21
 
 
<210>	63
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 8, 9, 12, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 7, 10, 11, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	63
uguacgacca auguaaacat t	21
 
 
<210>	64
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 7, 9, 10, 13, 14, 16, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 6, 8, 11, 12, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	64
uguuuacauu ggucguacat t	21
 
 
<210>	65
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 8, 10, 11, 15, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 7, 9, 12, 13, 14, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	65
uaccggacac uaaacccaat t	21
 
 
<210>	66
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 7, 8, 11, 13, 14, 15, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 9, 10, 12, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	66
uuggguuuag uguccgguat t	21
 
 
<210>	67
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 7, 8, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 6, 9, 10, 11, 12, 13, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	67
ccgcuaucga aaaugucuut t	21
 
 
<210>	68
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 7, 8, 9, 10, 11, 14, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 12, 13, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	68
aagacauuuu cgauagcggt t	21
 
 
<210>	69
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 9, 10, 11, 13, 14, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 7, 8, 12, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	69
agaucagacc uguugauagt t	21
 
 
<210>	70
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 8, 12, 13, 14, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 6, 7, 9, 10, 11, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	70
cuaucaacag gucugaucut t	21
 
 
<210>	71
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 8, 10, 12, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 7, 9, 11, 13, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	71
uccuauguau guguuaucut t	21
 
 
<210>	72
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 7, 9, 11, 13, 15
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 8, 10, 12, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	72
agauaacaca uacauaggat t	21
 
 
<210>	73
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 7, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 6, 8, 9, 10, 11, 12, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	73
ucuguaugaa aaccuuacut t	21
 
 
<210>	74
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 8, 9, 10, 11, 12, 14, 16
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 13, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	74
aguaagguuu ucauacagat t	21
 
 
<210>	75
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 8, 11, 12, 13, 14, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 9, 10, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	75
aaaacaauag uuccugcaat t	21
 
 
<210>	76
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 10, 11, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 7, 8, 9, 12, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	76
uugcaggaac uauuguuuut t	21
 
 
<210>	77
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 8, 9, 10, 12, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 6, 7, 11, 13, 14, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	77
gucuuaacuu guggaagcut t	21
 
 
<210>	78
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 7, 9, 13, 14, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 8, 10, 11, 12, 15, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	78
agcuuccaca aguuaagact t	21
 
 
<210>	79
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 5, 8, 9, 10, 11, 12, 14, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 7, 13, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	79
acaauaguuc cugcaacgut t	21
 
 
<210>	80
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 7, 13, 14, 16, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 8, 9, 10, 11, 12, 15, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	80
acguugcagg aacuauugut t	21
 
 
<210>	81
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 7, 8, 9, 11, 12, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 10, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	81
aggcuuuuca uuaaaugggt t	21
 
 
<210>	82
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 10, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 8, 9, 11, 12, 13, 14, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	82
cccauuuaau gaaaagccut t	21
 
 
<210>	83
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 9, 10, 11, 14, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 6, 7, 8, 12, 13, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	83
guuccagacu caacuuggat t	21
 
 
<210>	84
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	84
uccaaguuga gucuggaact t	21
 
 
<210>	85
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 9, 10, 13, 15, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 7, 8, 11, 12, 14, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	85
auguacgacc aauguaaact t	21
 
 
<210>	86
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 6, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	86
guuuacauug gucguacaut t	21
 
 
<210>	87
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 10, 11, 12, 13, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 7, 8, 9, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	87
cuacaggagu cucacaagat t	21
 
 
<210>	88
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 11, 12, 13, 14, 15, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 7, 8, 9, 10, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	88
ucuugugaga cuccuguagt t	21
 
 
<210>	89
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 8, 9, 12, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 7, 10, 11, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	89
uguacgacca auguaaacat t	21
 
 
<210>	90
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 7, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 8, 9, 10, 11, 12, 13, 14, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	90
uguuuacauu ggucguacat t	21
 
 
<210>	91
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 6, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 7, 8, 9, 10, 11, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	91
aggaucagaa gccuauuuut t	21
 
 
<210>	92
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 9, 10, 11, 12, 13, 16, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 14, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	92
aaaauaggcu ucugauccut t	21
 
 
<210>	93
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 6, 11, 14, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 7, 8, 9, 10, 12, 13, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	93
gaaauuagaa ugaccuacat t	21
 
 
<210>	94
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 8, 13
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	94
uguaggucau ucuaauuuct t	21
 
 
<210>	95
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 10, 13, 15, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 9, 11, 12, 14, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	95
uucuguucau ggugugagut t	21
 
 
<210>	96
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 8, 9, 11, 15
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 7, 10, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	96
acucacacca ugaacagaat t	21
 
 
<210>	97
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 9, 10, 11, 14, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 6, 7, 8, 12, 13, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	97
guuccagacu caacuuggat t	21
 
 
<210>	98
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 7, 8, 12, 13, 14, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 9, 10, 11, 15, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	98
uccaaguuga gucuggaact t	21
 
 
<210>	99
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 8, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 9, 10, 11
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	99
ccagauguaa gcucuccuct t	21
 
 
<210>	100
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	11, 13
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	100
gaggagagcu uacaucuggt t	21
 
 
<210>	101
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 8, 11, 12, 14, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	6, 7, 9, 10, 13, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	101
uuucuaaugg cuauucaagt t	21
 
 
<210>	102
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 7, 10, 11, 13, 14
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 8, 9, 12, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	102
cuugaauagc cauuagaaat t	21
 
 
<210>	103
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 7, 8, 10, 11, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 9, 12, 13, 14, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	103
augccgcuau cgaaaaugut t	21
 
 
<210>	104
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 7, 8, 11, 14, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 9, 10, 12, 13, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	104
acauuuucga uagcggcaut t	21
 
 
<210>	105
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 9, 10, 12, 13, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 8, 11, 14, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	105
ccagcaugcc gcuaucgaat t	21
 
 
<210>	106
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 9, 12, 14, 16, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 7, 8, 10, 11, 13, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	106
uucgauagcg gcaugcuggt t	21
 
 
<210>	107
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 8, 9, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 10, 11, 12, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	107
uuggcgcuca aaaaauagat t	21
 
 
<210>	108
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	108
ucuauuuuuu gagcgccaat t	21
 
 
<210>	109
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 9, 10, 11, 12, 13, 15, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 7, 8, 14, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	109
uccaccaauu cccguuggut t	21
 
 
<210>	110
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 12, 13, 16
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 7, 8, 9, 10, 11, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	110
accaacggga auugguggat t	21
 
 
<210>	111
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 7, 10, 11, 12, 13, 14, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 8, 9, 15, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	111
aaacaauagu uccugcaact t	21
 
 
<210>	112
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 11, 12, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 4, 6, 7, 8, 9, 10, 13, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	112
guugcaggaa cuauuguuut t	21
 
 
<210>	113
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 10, 13, 15, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 9, 11, 12, 14, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	113
uucuguucau ggugugagut t	21
 
 
<210>	114
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 6, 9, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 7, 8, 10, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	114
acucacacca ugaacagaat t	21
 
 
<210>	115
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 8, 12, 13, 14, 15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 7, 9, 10, 11, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	115
agcauugcaa accucaauat t	21
 
 
<210>	116
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 13
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	116
uauugagguu ugcaaugcut t	21
 
 
<210>	117
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 14, 15, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 8, 13, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	117
gccucucauu uuaccggact t	21
 
 
<210>	118
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 7, 12, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	118
guccgguaaa augagaggct t	21
 
 
<210>	119
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	119
cagcaucccu uucucaacat t	21
 
 
<210>	120
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1..19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	120
uguugagaaa gggaugcugt t	21
 
 
<210>	121
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 6, 8, 10, 14, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 7, 9, 11, 12, 13, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	121
gagaucauau agacaaucat t	21
 
 
<210>	122
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	9, 11
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	122
ugauugucua uaugaucuct t	21
 
 
<210>	123
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 8, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 9, 10, 11, 12, 13, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	123
ggcuguauga aaauacccut t	21
 
 
<210>	124
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 11, 13, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	124
aggguauuuu cauacagcct t	21
 
 
<210>	125
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 8, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	125
acgauucauu ccuuuuggat t	21
 
 
<210>	126
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	126
uccaaaagga augaaucgut t	21
 
 
<210>	127
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 8, 11, 12, 13, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 6, 7, 9, 10, 14, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	127
ugggaaauga ccugggauut t	21
 
 
<210>	128
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 11, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	128
aaucccaggu cauuucccat t	21
 
 
<210>	129
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 7, 15, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	129
cccagguaaa gagacgaaut t	21
 
 
<210>	130
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 13, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	130
auucgucucu uuaccugggt t	21
 
 
<210>	131
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	131
cagcaucccu uucucaacat t	21
 
 
<210>	132
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 15, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	132
uguugagaaa gggaugcugt t	21
 
 
<210>	133
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 13, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	133
cagguaaaga gacgaaugat t	21
 
 
<210>	134
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 7, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	134
ucauucgucu cuuuaccugt t	21
 
 
<210>	135
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 6, 7, 8, 10, 11, 12, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 9, 13, 14, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	135
aauaacuugc uuaacuacat t	21
 
 
<210>	136
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 7, 11, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 8, 9, 10, 12, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	136
uguaguuaag caaguuauut t	21
 
 
<210>	137
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 12, 13, 14, 15, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 7, 8, 9, 10, 11, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	137
cuguaugaaa accuuacugt t	21
 
 
<210>	138
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 9, 10, 11, 12, 13, 15, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 7, 8, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	138
caguaagguu uucauacagt t	21
 
 
<210>	139
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 7, 8, 9, 10, 14, 15, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 6, 11, 12, 13, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	139
gcucuguucc agacucaact t	21
 
 
<210>	140
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 7, 8, 9, 14, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 6, 10, 11, 12, 13, 15, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	140
guugagucug gaacagagct t	21
 
 
<210>	141
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 8, 12, 15, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 7, 9, 10, 11, 13, 14, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	141
ggcucaguaa gcaaugcgct t	21
 
 
<210>	142
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 7, 9, 10, 11, 13, 14, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 8, 12, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	142
gcgcauugcu uacugagcct t	21
 
 
<210>	143
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 6, 8, 10, 14, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 7, 9, 11, 12, 13, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	143
gagaucauau agacaaucat t	21
 
 
<210>	144
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 7, 8, 9, 11, 13, 16, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 10, 12, 14, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	144
ugauugucua uaugaucuct t	21
 
 
<210>	145
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 6, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 7, 8, 9, 10, 11, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	145
aggaucagaa gccuauuuut t	21
 
 
<210>	146
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	146
aaaauaggcu ucugauccut t	21
 
 
<210>	147
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 6, 8, 9, 11, 12, 14, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 7, 10, 13, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	147
cagcaugccg cuaucgaaat t	21
 
 
<210>	148
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 13
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	148
uuucgauagc ggcaugcugt t	21
 
 
<210>	149
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 8, 10, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 7, 9, 11, 12, 13, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	149
uguuauaugc aggauaugat t	21
 
 
<210>	150
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 7, 8, 9, 11, 13, 15, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 10, 12, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	150
ucauauccug cauauaacat t	21
 
 
<210>	151
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 7, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 8, 9, 10, 11, 12, 14
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	151
cgcuaucgaa aaugucuuct t	21
 
 
<210>	152
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 8, 9, 10, 11, 12, 15, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 13, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	152
gaagacauuu ucgauagcgt t	21
 
 
<210>	153
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 9, 10, 12, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 11, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	153
gguggagauc auauagacat t	21
 
 
<210>	154
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 7, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	154
ugucuauaug aucuccacct t	21
 
 
<210>	155
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 8, 9, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 10, 11, 12, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	155
uuggcgcuca aaaaauagat t	21
 
 
<210>	156
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 8, 9, 10, 14, 16, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 11, 12, 13, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	156
ucuauuuuuu gagcgccaat t	21
 
 
<210>	157
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 9, 10, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 8, 11, 12, 13, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	157
ucauuuuacc ggacacuaat t	21
 
 
<210>	158
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 12
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	158
uuaguguccg guaaaaugat t	21
 
 
<210>	159
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 7, 10, 15, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 8, 9, 11, 12, 13, 14, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	159
caucaucgau aaaauucgat t	21
 
 
<210>	160
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	9
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	160
ucgaauuuua ucgaugaugt t	21
 
 
<210>	161
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	161
ccagguaaag agacgaaugt t	21
 
 
<210>	162
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 13
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	162
cauucgucuc uuuaccuggt t	21
 
 
<210>	163
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 7, 8, 12, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 9, 10, 11, 13, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	163
caggcuucag guaucuuaut t	21
 
 
<210>	164
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 7
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	164
auaagauacc ugaagccugt t	21
 
 
<210>	165
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 12, 13, 14, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	6, 7, 8, 9, 10, 11, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	165
uuuccaaaag gcucaguaat t	21
 
 
<210>	166
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	166
uuacugagcc uuuuggaaat t	21
 
 
<210>	167
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 7, 8, 11, 12, 13, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 9, 10, 14, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	167
cacacauuaa ucugauuuut t	21
 
 
<210>	168
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 11
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	168
aaaaucagau uaaugugugt t	21
 
 
<210>	169
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 8, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 9, 10, 11, 12, 13, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	169
ggcuguauga aaauacccut t	21
 
 
<210>	170
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 7, 8, 9, 10, 11, 13, 15, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 12, 14, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	170
aggguauuuu cauacagcct t	21
 
 
<210>	171
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 7, 8, 14, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 9, 10, 11, 12, 13, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	171
cagguuucag gaacuuacat t	21
 
 
<210>	172
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	172
uguaaguucc ugaaaccugt t	21
 
 
<210>	173
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 6, 11, 14, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 7, 8, 9, 10, 12, 13, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	173
gaaauuagaa ugaccuacat t	21
 
 
<210>	174
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 7, 8, 10, 11, 12, 13, 16, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 9, 14, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	174
uguaggucau ucuaauuuct t	21
 
 
<210>	175
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 9, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 8, 10, 11, 12, 13, 14
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	175
ccaagcagcg aagacuuuut t	21
 
 
<210>	176
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 7, 8, 9, 10, 12, 13, 15, 16, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 11, 14, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	176
aaaagucuuc gcugcuuggt t	21
 
 
<210>	177
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 9, 10, 11, 12, 13, 15, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 7, 8, 14, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	177
uccaccaauu cccguuggut t	21
 
 
<210>	178
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	178
accaacggga auugguggat t	21
 
 
<210>	179
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 8, 9, 10, 11, 14, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 7, 12, 13, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	179
ccaacaaucu uggcgcucat t	21
 
 
<210>	180
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	8
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	180
ugagcgccaa gauuguuggt t	21
 
 
<210>	181
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 10, 13, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 7, 8, 9, 11, 12, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	181
cucaguaagc aaugcgcagt t	21
 
 
<210>	182
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 13
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	182
cugcgcauug cuuacugagt t	21
 
 
<210>	183
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 7, 12, 13, 15, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 6, 8, 9, 10, 11, 14, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	183
ucucaauggg acuguauaut t	21
 
 
<210>	184
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 9, 10, 11, 12, 14, 15
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 7, 8, 13, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	184
auauacaguc ccauugagat t	21
 
 
<210>	185
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	11, 12, 13, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	185
aaaaagaaga uuucaucgat t	21
 
 
<210>	186
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 7, 8, 9
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	186
ucgaugaaau cuucuuuuut t	21
 
 
<210>	187
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 8, 11, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 7, 9, 10, 12, 13, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	187
gaacuggcag cgguuuuaut t	21
 
 
<210>	188
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 7, 8, 10, 11, 13, 14, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 9, 12, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	188
auaaaaccgc ugccaguuct t	21
 
 
<210>	189
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 7, 8, 9, 10, 14, 15, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 6, 11, 12, 13, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	189
gcucuguucc agacucaact t	21
 
 
<210>	190
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	190
guugagucug gaacagagct t	21
 
 
<210>	191
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 7, 8, 9, 10, 11, 13, 14, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 12, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	191
caccaauucc cguugguuct t	21
 
 
<210>	192
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 8, 14, 15, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 7, 9, 10, 11, 12, 13, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	192
gaaccaacgg gaauuggugt t	21
 
 
<210>	193
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 7, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 8, 9, 10, 11, 12, 14
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	193
cgcuaucgaa aaugucuuct t	21
 
 
<210>	194
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	194
gaagacauuu ucgauagcgt t	21
 
 
<210>	195
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 7, 8, 10, 11, 13, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 9, 12, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	195
agcaugccgc uaucgaaaat t	21
 
 
<210>	196
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 8, 11, 14, 16, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	6, 7, 9, 10, 12, 13, 15, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	196
uuuucgauag cggcaugcut t	21
 
 
<210>	197
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 7, 8, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 9, 10, 11, 12, 13, 14, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	197
cucaacuugg aggaucaugt t	21
 
 
<210>	198
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 11
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	198
caugauccuc caaguugagt t	21
 
 
<210>	199
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 8, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 9, 10, 11
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	199
ccagauguaa gcucuccuct t	21
 
 
<210>	200
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	9, 10, 11, 13, 15, 16, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 12, 14, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	200
gaggagagcu uacaucuggt t	21
 
 
<210>	201
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 9, 10, 13, 14, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 11, 12, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	201
agugagaguu gguuacucat t	21
 
 
<210>	202
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 9, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	202
ugaguaacca acucucacut t	21
 
 
<210>	203
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 7, 11, 14, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 8, 9, 10, 12, 13, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	203
gggcggcaag ugauugcagt t	21
 
 
<210>	204
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 8
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	204
cugcaaucac uugccgccct t	21
 
 
<210>	205
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 10, 11, 12, 13, 14, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 7, 8, 9, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	205
ugugauggac uucuauaaat t	21
 
 
<210>	206
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 11, 12, 13, 15, 16, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 6, 7, 8, 9, 10, 14, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	206
uuuauagaag uccaucacat t	21
 
 
<210>	207
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 9, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 8, 10, 11, 12, 13, 14
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	207
ccaagcagcg aagacuuuut t	21
 
 
<210>	208
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1..19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	208
aaaagucuuc gcugcuuggt t	21
 
 
<210>	209
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 8, 11, 12, 13, 14, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 9, 10, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	209
aaaacaauag uuccugcaat t	21
 
 
<210>	210
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 11
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	210
uugcaggaac uauuguuuut t	21
 
 
<210>	211
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 7, 8, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 6, 9, 10, 11, 12, 13, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	211
ccgcuaucga aaaugucuut t	21
 
 
<210>	212
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	212
aagacauuuu cgauagcggt t	21
 
 
<210>	213
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 6, 8, 9, 11, 12, 14, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 7, 10, 13, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	213
cagcaugccg cuaucgaaat t	21
 
 
<210>	214
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 7, 10, 13, 15, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 6, 8, 9, 11, 12, 14, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	214
uuucgauagc ggcaugcugt t	21
 
 
<210>	215
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 9, 10, 11, 12, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 8, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	215
cuggugugcu cugaugaagt t	21
 
 
<210>	216
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 12, 14, 16, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 8, 9, 10, 11, 13, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	216
cuucaucaga gcacaccagt t	21
 
 
<210>	217
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 9, 11, 13, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 7, 8, 10, 12, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	217
acgcucaaca uguuaggagt t	21
 
 
<210>	218
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 8
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	218
cuccuaacau guugagcgut t	21
 
 
<210>	219
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 7, 10, 11, 12, 13, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 6, 8, 9, 14, 15, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	219
ucccaacaau cuuggcgcut t	21
 
 
<210>	220
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 11, 12, 14, 15
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 7, 8, 9, 10, 13, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	220
agcgccaaga uuguugggat t	21
 
 
<210>	221
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 8, 14, 15, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 9, 10, 11, 12, 13, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	221
agacgaauga gaguccuugt t	21
 
 
<210>	222
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 7, 8, 9, 10, 11, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 6, 12, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	222
caaggacucu cauucgucut t	21
 
 
<210>	223
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 8, 10, 11, 15, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 7, 9, 12, 13, 14, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	223
uaccggacac uaaacccaat t	21
 
 
<210>	224
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	8, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	224
uuggguuuag uguccgguat t	21
 
 
<210>	225
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 7, 9, 10, 12, 13, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 8, 11, 14, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	225
cugcaacguu accacaacut t	21
 
 
<210>	226
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	9, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	226
aguuguggua acguugcagt t	21
 
 
<210>	227
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 9, 10, 12, 13, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 8, 11, 14, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	227
ccagcaugcc gcuaucgaat t	21
 
 
<210>	228
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 12
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	228
uucgauagcg gcaugcuggt t	21
 
 
<210>	229
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 8, 12, 13, 14, 15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 7, 9, 10, 11, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	229
agcauugcaa accucaauat t	21
 
 
<210>	230
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 9, 10, 11, 13, 16, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 7, 8, 12, 14, 15, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	230
uauugagguu ugcaaugcut t	21
 
 
<210>	231
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 7, 10, 11, 12, 13, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 6, 8, 9, 14, 15, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	231
ucccaacaau cuuggcgcut t	21
 
 
<210>	232
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	232
agcgccaaga uuguugggat t	21
 
 
<210>	233
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 8, 9, 10, 11, 12, 14, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 6, 7, 13, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	233
ccaccaauuc ccguugguut t	21
 
 
<210>	234
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	234
aaccaacggg aauugguggt t	21
 
 
<210>	235
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 7, 8, 10, 11, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 9, 12, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	235
ucagaccugu ugauagaugt t	21
 
 
<210>	236
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 7, 8, 11, 15, 16, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 6, 9, 10, 12, 13, 14, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	236
caucuaucaa caggucugat t	21
 
 
<210>	237
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 9, 11, 12, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 6, 7, 8, 10, 13, 14, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	237
uuaccggaca cuaaacccat t	21
 
 
<210>	238
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	238
uggguuuagu guccgguaat t	21
 
 
<210>	239
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 9, 10, 11, 12, 15, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 7, 8, 13, 14, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	239
cccaacaauc uuggcgcuct t	21
 
 
<210>	240
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 6, 7, 12, 13, 15, 16
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 8, 9, 10, 11, 14, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	240
gagcgccaag auuguugggt t	21
 
 
<210>	241
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 8, 11, 12, 14, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	6, 7, 9, 10, 13, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	241
uuucuaaugg cuauucaagt t	21
 
 
<210>	242
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 11, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	242
cuugaauagc cauuagaaat t	21
 
 
<210>	243
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 8, 10, 11, 12, 13, 15, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 9, 14, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	243
uuaaugucau uccaccaaut t	21
 
 
<210>	244
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	14, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	244
auugguggaa ugacauuaat t	21
 
 
<210>	245
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 8, 12, 15, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 7, 9, 10, 11, 13, 14, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	245
ggcucaguaa gcaaugcgct t	21
 
 
<210>	246
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 11
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	246
gcgcauugcu uacugagcct t	21
 
 
<210>	247
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 8, 9, 10, 12, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 6, 7, 11, 13, 14, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	247
gucuuaacuu guggaagcut t	21
 
 
<210>	248
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 9, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	248
agcuuccaca aguuaagact t	21
 
 
<210>	249
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 9, 10, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 8, 11, 12, 13, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	249
ucauuuuacc ggacacuaat t	21
 
 
<210>	250
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 8, 9, 12, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 10, 11, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	250
uuaguguccg guaaaaugat t	21
 
 
<210>	251
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 8, 14, 15, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 9, 10, 11, 12, 13, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	251
agacgaauga gaguccuugt t	21
 
 
<210>	252
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 11
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	252
caaggacucu cauucgucut t	21
 
 
<210>	253
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 10, 11, 12, 13, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 4, 6, 7, 8, 9, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	253
acuguaaaac cuuguguggt t	21
 
 
<210>	254
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 11, 12, 13, 14, 16, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 7, 8, 9, 10, 15, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	254
ccacacaagg uuuuacagut t	21
 
 
<210>	255
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 9, 13, 14, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 7, 8, 10, 11, 12, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	255
aaccucaaua ggucgaccat t	21
 
 
<210>	256
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	10
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	256
uggucgaccu auugagguut t	21
 
 
<210>	257
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 6, 10, 13, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 7, 8, 9, 11, 12, 14, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	257
caugcugaau aauaaucugt t	21
 
 
<210>	258
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 8, 9, 11, 12, 13, 16, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 7, 10, 14, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	258
cagauuauua uucagcaugt t	21
 
 
<210>	259
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 7, 8, 9, 10, 13, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 11, 12, 14, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	259
ugcaaaccuc aauaggucgt t	21
 
 
<210>	260
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	260
cgaccuauug agguuugcat t	21
 
 
<210>	261
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 8, 9, 10, 11, 14, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 7, 12, 13, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	261
ccaacaaucu uggcgcucat t	21
 
 
<210>	262
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 7, 8, 13, 14, 16, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 9, 10, 11, 12, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	262
ugagcgccaa gauuguuggt t	21
 
 
<210>	263
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 12, 13, 14, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 7, 8, 9, 10, 11, 15, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	263
gguuucagga acuuacacct t	21
 
 
<210>	264
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	264
gguguaaguu ccugaaacct t	21
 
 
<210>	265
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 12, 13, 14, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 7, 8, 9, 10, 11, 15, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	265
gguuucagga acuuacacct t	21
 
 
<210>	266
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 9, 10, 11, 12, 13, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 7, 8, 14, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	266
gguguaaguu ccugaaacct t	21
 
 
<210>	267
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 7, 8, 12, 13, 14, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 9, 10, 11, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	267
uagugaccag guuuucaggt t	21
 
 
<210>	268
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	268
ccugaaaacc uggucacuat t	21
 
 
<210>	269
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 7, 9, 10, 12, 13, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 8, 11, 14, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	269
cugcaacguu accacaacut t	21
 
 
<210>	270
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 9, 12, 14, 15, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 8, 10, 11, 13, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	270
aguuguggua acguugcagt t	21
 
 
<210>	271
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 7, 8, 10, 11, 13, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 9, 12, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	271
agcaugccgc uaucgaaaat t	21
 
 
<210>	272
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	8, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	272
uuuucgauag cggcaugcut t	21
 
 
<210>	273
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 8, 9, 11, 12, 14, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 7, 10, 13, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	273
ugcaacguua ccacaacuct t	21
 
 
<210>	274
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	10, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	274
gaguuguggu aacguugcat t	21
 
 
<210>	275
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 7, 12, 14, 15, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 8, 9, 10, 11, 13, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	275
ugaaccugaa guguuauaut t	21
 
 
<210>	276
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 7, 9, 10, 11, 12, 16, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 6, 8, 13, 14, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	276
auauaacacu ucagguucat t	21
 
 
<210>	277
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 7, 8, 9, 10, 11, 13, 14, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 12, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	277
caccaauucc cguugguuct t	21
 
 
<210>	278
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	278
gaaccaacgg gaauuggugt t	21
 
 
<210>	279
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	279
ccagguaaag agacgaaugt t	21
 
 
<210>	280
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 6, 14, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	280
cauucgucuc uuuaccuggt t	21
 
 
<210>	281
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 8, 13, 14, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	6, 7, 9, 10, 11, 12, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	281
cucucaaugg gacuguauat t	21
 
 
<210>	282
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 8, 9, 10, 11, 13, 14
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 7, 12, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	282
uauacagucc cauugagagt t	21
 
 
<210>	283
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 6, 7, 8, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	283
uggcgcucaa aaaauagaat t	21
 
 
<210>	284
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 15, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 12, 13, 14, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	284
uucuauuuuu ugagcgccat t	21
 
 
<210>	285
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 7, 8, 9, 10, 11, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 12, 13, 14, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	285
auacccuccu caaauaacut t	21
 
 
<210>	286
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 7, 8, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 9, 10, 11, 12, 13, 14, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	286
aguuauuuga ggaggguaut t	21
 
 
<210>	287
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 7, 11, 14, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 8, 9, 10, 12, 13, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	287
gggcggcaag ugauugcagt t	21
 
 
<210>	288
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 7, 8, 10, 11, 12, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 9, 13, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	288
cugcaaucac uugccgccct t	21
 
 
<210>	289
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 8, 9, 11, 13, 15, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 6, 7, 10, 12, 14, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	289
ugcuuaacua cauauagaut t	21
 
 
<210>	290
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 6, 10, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 7, 8, 9, 11, 12, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	290
aucuauaugu aguuaagcat t	21
 
 
<210>	291
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 7, 8, 11, 12, 13, 14, 15, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 6, 9, 10, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	291
auuccaccaa uucccguugt t	21
 
 
<210>	292
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 10, 11, 14, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 7, 8, 9, 12, 13, 15, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	292
caacgggaau ugguggaaut t	21
 
 
<210>	293
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 8, 12, 13, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 6, 7, 9, 10, 11, 14, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	293
accucaauag gucgaccagt t	21
 
 
<210>	294
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	11
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	294
cuggucgacc uauugaggut t	21
 
 
<210>	295
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 9, 11, 15, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 7, 8, 10, 12, 13, 14, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	295
guucauggug ugaguaccut t	21
 
 
<210>	296
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 6, 7, 8, 10, 12, 13, 15, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 9, 11, 14, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	296
agguacucac accaugaact t	21
 
 
<210>	297
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 13, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	7, 12, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	297
ccucucauuu uaccggacat t	21
 
 
<210>	298
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	8
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	298
uguccgguaa aaugagaggt t	21
 
 
<210>	299
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 9, 14, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	299
agccucucau uuuaccggat t	21
 
 
<210>	300
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 11, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	300
uccgguaaaa ugagaggcut t	21
 
 
<210>	301
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 10, 11, 13, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 7, 8, 9, 12, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	301
ucaaugggac uguauauggt t	21
 
 
<210>	302
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 8, 11, 12, 13, 14, 16, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 7, 9, 10, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	302
ccauauacag ucccauugat t	21
 
 
<210>	303
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 7, 8, 12, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 9, 10, 11, 13, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	303
caggcuucag guaucuuaut t	21
 
 
<210>	304
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 7, 9, 10, 11, 16, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 8, 12, 13, 14, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	304
auaagauacc ugaagccugt t	21
 
 
<210>	305
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 7, 11, 12, 14, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 8, 9, 10, 13, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	305
auucagcagg ccacuacagt t	21
 
 
<210>	306
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 7, 10, 11, 12, 14, 15, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 8, 9, 13, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	306
cuguaguggc cugcugaaut t	21
 
 
<210>	307
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 9, 10, 11, 12, 15, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 7, 8, 13, 14, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	307
cccaacaauc uuggcgcuct t	21
 
 
<210>	308
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	308
gagcgccaag auuguugggt t	21
 
 
<210>	309
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 7, 8, 12, 14, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 9, 10, 11, 13, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	309
augagaccag auguaagcut t	21
 
 
<210>	310
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 7, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	310
agcuuacauc uggucucaut t	21
 
 
<210>	311
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 6, 10, 13, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 7, 8, 9, 11, 12, 14, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	311
caugcugaau aauaaucugt t	21
 
 
<210>	312
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 6, 9, 13, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 7, 8, 10, 11, 12, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	312
cagauuauua uucagcaugt t	21
 
 
<210>	313
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 9, 12, 13, 14, 15, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 7, 8, 10, 11, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	313
acuggcagcg guuuuaucat t	21
 
 
<210>	314
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	314
ugauaaaacc gcugccagut t	21
 
 
<210>	315
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 7, 8, 9, 10, 12, 13, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 11, 14, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	315
aucugguuuu gucaagccct t	21
 
 
<210>	316
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 9, 14, 15, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 7, 8, 10, 11, 12, 13, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	316
gggcuugaca aaaccagaut t	21
 
 
<210>	317
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 7, 8, 11, 12, 14, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 6, 9, 10, 13, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	317
ugagaguugg uuacucacat t	21
 
 
<210>	318
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 11, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	318
ugugaguaac caacucucat t	21
 
 
<210>	319
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 8, 9, 10, 11, 12, 14, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 6, 7, 13, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	319
ccaccaauuc ccguugguut t	21
 
 
<210>	320
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 7, 13, 14, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 6, 8, 9, 10, 11, 12, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	320
aaccaacggg aauugguggt t	21
 
 
<210>	321
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 9, 11, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 7, 8, 10, 12, 13, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	321
aaacugggca caguuuacut t	21
 
 
<210>	322
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 7, 8, 10, 12, 13, 14, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 9, 11, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	322
aguaaacugu gcccaguuut t	21
 
 
<210>	323
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 9, 11, 15, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 7, 8, 10, 12, 13, 14, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	323
guucauggug ugaguaccut t	21
 
 
<210>	324
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 8, 10, 13
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 9, 11, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	324
agguacucac accaugaact t	21
 
 
<210>	325
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 7, 8, 9, 10, 11, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 12, 13, 14, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	325
auacccuccu caaauaacut t	21
 
 
<210>	326
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	326
aguuauuuga ggaggguaut t	21
 
 
<210>	327
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 9, 11, 12, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 6, 7, 8, 10, 13, 14, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	327
uuaccggaca cuaaacccat t	21
 
 
<210>	328
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 7, 10, 12, 13, 14, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 8, 9, 11, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	328
uggguuuagu guccgguaat t	21
 
 
<210>	329
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 8, 9, 10, 14, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 7, 11, 12, 13, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	329
acuuacaccu ggaugaccat t	21
 
 
<210>	330
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 7, 8, 9, 13, 15, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 10, 11, 12, 14, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	330
uggucaucca gguguaagut t	21
 
 
<210>	331
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 10, 13, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 7, 8, 9, 11, 12, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	331
cucaguaagc aaugcgcagt t	21
 
 
<210>	332
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 8, 9, 11, 12, 13, 15, 16
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 7, 10, 14, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	332
cugcgcauug cuuacugagt t	21
 
 
<210>	333
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 8, 9, 10, 11, 13, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 7, 12, 14, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	333
uuugacauuu ugcaggauut t	21
 
 
<210>	334
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 8, 13, 15, 16
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 7, 9, 10, 11, 12, 14, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	334
aauccugcaa aaugucaaat t	21
 
 
<210>	335
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 7, 8, 10, 11, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 9, 12, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	335
ucagaccugu ugauagaugt t	21
 
 
<210>	336
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 8, 11
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	336
caucuaucaa caggucugat t	21
 
 
<210>	337
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 7, 11, 12, 14, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 8, 9, 10, 13, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	337
auucagcagg ccacuacagt t	21
 
 
<210>	338
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	338
cuguaguggc cugcugaaut t	21
 
 
<210>	339
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 7, 8, 9, 11, 14, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 10, 12, 13, 15, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	339
auaguuccug caacguuact t	21
 
 
<210>	340
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 5, 7, 8, 10, 16, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 9, 11, 12, 13, 14, 15, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	340
guaacguugc aggaacuaut t	21
 
 
<210>	341
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 8, 9, 11, 12, 14, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 7, 10, 13, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	341
ugcaacguua ccacaacuct t	21
 
 
<210>	342
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 7, 10, 13, 15, 16, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 8, 9, 11, 12, 14, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	342
gaguuguggu aacguugcat t	21
 
 
<210>	343
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 6, 7, 8, 9, 11, 12, 13, 15, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 10, 14, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	343
uaguuuuuua uucaugcugt t	21
 
 
<210>	344
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 6, 10, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 7, 8, 9, 11, 12, 13, 14, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	344
cagcaugaau aaaaaacuat t	21
 
 
<210>	345
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 8, 11, 12, 13, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 6, 7, 9, 10, 14, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	345
ugggaaauga ccugggauut t	21
 
 
<210>	346
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 10, 11, 13, 14, 15, 16, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 7, 8, 9, 12, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	346
aaucccaggu cauuucccat t	21
 
 
<210>	347
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 8, 9, 10, 11, 13, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 7, 12, 14, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	347
uuugacauuu ugcaggauut t	21
 
 
<210>	348
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	8, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	348
aauccugcaa aaugucaaat t	21
 
 
<210>	349
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 9, 11, 13, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 7, 8, 10, 12, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	349
acgcucaaca uguuaggagt t	21
 
 
<210>	350
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 8, 10, 12, 13, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	6, 7, 9, 11, 14, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	350
cuccuaacau guugagcgut t	21
 
 
<210>	351
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 7, 8, 9, 12, 14, 15, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 10, 11, 13, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	351
ugcuguucug guauuaccat t	21
 
 
<210>	352
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 7, 9, 10, 15, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 8, 11, 12, 13, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	352
ugguaauacc agaacagcat t	21
 
 
<210>	353
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 7, 15, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	353
cccagguaaa gagacgaaut t	21
 
 
<210>	354
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	12
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	354
auucgucucu uuaccugggt t	21
 
 
<210>	355
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 7, 8, 9, 10, 13, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 11, 12, 14, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	355
ugcaaaccuc aauaggucgt t	21
 
 
<210>	356
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 6, 8, 9, 14, 15, 16, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 7, 10, 11, 12, 13, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	356
cgaccuauug agguuugcat t	21
 
 
<210>	357
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 14, 15, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 8, 13, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	357
gccucucauu uuaccggact t	21
 
 
<210>	358
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	358
guccgguaaa augagaggct t	21
 
 
<210>	359
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 7, 8, 9, 12, 14, 15, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 10, 11, 13, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	359
ugcuguucug guauuaccat t	21
 
 
<210>	360
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 7, 10, 15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 8, 9, 11, 12, 13, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	360
ugguaauacc agaacagcat t	21
 
 
<210>	361
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 8, 11, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 7, 9, 10, 12, 13, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	361
gaacuggcag cgguuuuaut t	21
 
 
<210>	362
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	362
auaaaaccgc ugccaguuct t	21
 
 
<210>	363
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 7, 9, 11, 13, 14, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 6, 8, 10, 12, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	363
ccuauguaug uguuaucugt t	21
 
 
<210>	364
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 8, 10, 12, 14, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 7, 9, 11, 13, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	364
cagauaacac auacauaggt t	21
 
 
<210>	365
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 8, 9, 10, 12, 13, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 11, 14, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	365
agaagauuuc aucgaacuct t	21
 
 
<210>	366
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 9, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 7, 8, 10, 11, 12, 13
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	366
gaguucgaug aaaucuucut t	21
 
 
<210>	367
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 8, 9, 10, 11, 12, 13, 14, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 6, 7, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	367
cucugaacuu cccuggucgt t	21
 
 
<210>	368
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 13, 14, 15
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 7, 8, 9, 10, 11, 12, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	368
cgaccaggga aguucagagt t	21
 
 
<210>	369
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 9, 10, 11, 12, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 8, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	369
cuggugugcu cugaugaagt t	21
 
 
<210>	370
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 7, 12, 14, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 8, 9, 10, 11, 13, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	370
cuucaucaga gcacaccagt t	21
 
 
<210>	371
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 7, 8, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 9, 10, 11, 12, 13, 14, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	371
cucaacuugg aggaucaugt t	21
 
 
<210>	372
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 7, 8, 9, 10, 11, 15, 16
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 12, 13, 14, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	372
caugauccuc caaguugagt t	21
 
 
<210>	373
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 9, 14, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	373
agccucucau uuuaccggat t	21
 
 
<210>	374
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	374
uccgguaaaa ugagaggcut t	21
 
 
<210>	375
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 7, 8, 9, 11, 14, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 10, 12, 13, 15, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	375
auaguuccug caacguuact t	21
 
 
<210>	376
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 10, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	376
guaacguugc aggaacuaut t	21
 
 
<210>	377
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 6, 9, 10, 11, 12, 13, 15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 7, 8, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	377
aacaauaguu ccugcaacgt t	21
 
 
<210>	378
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 12, 13, 15, 16, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 7, 8, 9, 10, 11, 14, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	378
cguugcagga acuauuguut t	21
 
 
<210>	379
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 7, 8, 9, 10, 12, 13, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 11, 14, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	379
aucugguuuu gucaagccct t	21
 
 
<210>	380
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	9, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	380
gggcuugaca aaaccagaut t	21
 
 
<210>	381
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 10, 11, 12, 13, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 4, 6, 7, 8, 9, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	381
acuguaaaac cuuguguggt t	21
 
 
<210>	382
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 14, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	382
ccacacaagg uuuuacagut t	21
 
 
<210>	383
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 7, 11, 12, 13, 14, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 8, 9, 10, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	383
aacucuugga uucuaugcat t	21
 
 
<210>	384
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 12
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	384
ugcauagaau ccaagaguut t	21
 
 
<210>	385
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 7, 8, 12, 13, 14, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 9, 10, 11, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	385
uagugaccag guuuucaggt t	21
 
 
<210>	386
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 9, 10, 11, 14, 15, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 7, 8, 12, 13, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	386
ccugaaaacc uggucacuat t	21
 
 
<210>	387
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 9, 13, 14, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 7, 8, 10, 11, 12, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	387
aaccucaaua ggucgaccat t	21
 
 
<210>	388
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 8, 9, 10, 12, 13, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 7, 11, 14, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	388
uggucgaccu auugagguut t	21
 
 
<210>	389
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 13, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	7, 12, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	389
ccucucauuu uaccggacat t	21
 
 
<210>	390
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 8, 13
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 6, 7, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	390
uguccgguaa aaugagaggt t	21
 
 
<210>	391
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 9, 12, 13, 14, 15, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 7, 8, 10, 11, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	391
ugaccaaaug acccuacugt t	21
 
 
<210>	392
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 9, 10, 12, 13, 14, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 7, 8, 11, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	392
caguaggguc auuuggucat t	21
 
 
<210>	393
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 9, 10, 11, 13, 14, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 7, 8, 12, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	393
agaucagacc uguugauagt t	21
 
 
<210>	394
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 5, 8
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	394
cuaucaacag gucugaucut t	21
 
 
<210>	395
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 7, 8, 14, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 9, 10, 11, 12, 13, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	395
cagguuucag gaacuuacat t	21
 
 
<210>	396
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 7, 8, 9, 10, 11, 16, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 12, 13, 14, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	396
uguaaguucc ugaaaccugt t	21
 
 
<210>	397
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 6, 7, 8, 9, 11, 12, 13, 15, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 10, 14, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	397
uaguuuuuua uucaugcugt t	21
 
 
<210>	398
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 10, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	398
cagcaugaau aaaaaacuat t	21
 
 
<210>	399
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 10, 11, 12, 13, 14, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 7, 8, 9, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	399
ugugauggac uucuauaaat t	21
 
 
<210>	400
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 13, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	400
uuuauagaag uccaucacat t	21
 
 
<210>	401
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 6, 7, 8, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	401
uggcgcucaa aaaauagaat t	21
 
 
<210>	402
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	402
uucuauuuuu ugagcgccat t	21
 
 
<210>	403
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 6, 9, 10, 11, 12, 13, 15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 7, 8, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	403
aacaauaguu ccugcaacgt t	21
 
 
<210>	404
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 13
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	404
cguugcagga acuauuguut t	21
 
 
<210>	405
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 7, 12, 14, 15, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 8, 9, 10, 11, 13, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	405
ugaaccugaa guguuauaut t	21
 
 
<210>	406
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 7, 12, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 6, 8, 9, 10, 11, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	406
auauaacacu ucagguucat t	21
 
 
<210>	407
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 8, 13, 14, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	6, 7, 9, 10, 11, 12, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	407
cucucaaugg gacuguauat t	21
 
 
<210>	408
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 11
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	408
uauacagucc cauugagagt t	21
 
 
<210>	409
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 7, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 6, 8, 9, 10, 11, 12, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	409
ucuguaugaa aaccuuacut t	21
 
 
<210>	410
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 12, 14, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 13, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	410
aguaagguuu ucauacagat t	21
 
 
<210>	411
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 7, 8, 10, 11, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 9, 12, 13, 14, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	411
augccgcuau cgaaaaugut t	21
 
 
<210>	412
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 11, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	412
acauuuucga uagcggcaut t	21
 
 
<210>	413
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 6, 7, 8, 10, 13, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 9, 11, 12, 14, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	413
uaguuccugc aacguuacct t	21
 
 
<210>	414
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 11, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	414
gguaacguug caggaacuat t	21
 
 
<210>	415
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 6, 7, 8, 9, 12, 14, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 10, 11, 13, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	415
aacaaucuug gcgcucaaat t	21
 
 
<210>	416
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 7, 9, 10, 15, 16, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 8, 11, 12, 13, 14, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	416
uuugagcgcc aagauuguut t	21
 
 
<210>	417
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 7, 10, 14, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 8, 9, 11, 12, 13, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	417
aaaccucaau aggucgacct t	21
 
 
<210>	418
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 7, 8, 9, 11, 12, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 6, 10, 13, 14, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	418
ggucgaccua uugagguuut t	21
 
 
<210>	419
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 12, 13, 14, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	6, 7, 8, 9, 10, 11, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	419
uuuccaaaag gcucaguaat t	21
 
 
<210>	420
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 9, 10, 11, 12, 13, 14
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 6, 7, 8, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	420
uuacugagcc uuuuggaaat t	21
 
 
<210>	421
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 7, 12, 13, 15, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 6, 8, 9, 10, 11, 14, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	421
ucucaauggg acuguauaut t	21
 
 
<210>	422
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 12
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	422
auauacaguc ccauugagat t	21
 
 
<210>	423
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 6, 7, 8, 9, 12, 14, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 10, 11, 13, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	423
aacaaucuug gcgcucaaat t	21
 
 
<210>	424
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	10
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	424
uuugagcgcc aagauuguut t	21
 
 
<210>	425
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 7, 11, 12, 13, 14, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 8, 9, 10, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	425
aacucuugga uucuaugcat t	21
 
 
<210>	426
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 10, 11, 12, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 7, 8, 9, 13, 14, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	426
ugcauagaau ccaagaguut t	21
 
 
<210>	427
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	11, 12, 13, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	427
aaaaagaaga uuucaucgat t	21
 
 
<210>	428
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1..19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	428
ucgaugaaau cuucuuuuut t	21
 
 
<210>	429
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 9, 12, 13, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 7, 8, 10, 11, 14, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	429
cauauagaca aucaagugct t	21
 
 
<210>	430
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 14, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	430
gcacuugauu gucuauaugt t	21
 
 
<210>	431
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 8, 9, 10, 14, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 5, 7, 11, 12, 13, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	431
acuuacaccu ggaugaccat t	21
 
 
<210>	432
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 9, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	432
uggucaucca gguguaagut t	21
 
 
<210>	433
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 10, 12, 13, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 7, 8, 9, 11, 14, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	433
uuuaccggac acuaaaccct t	21
 
 
<210>	434
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 9, 11, 12, 13, 16
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 7, 8, 10, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	434
ggguuuagug uccgguaaat t	21
 
 
<210>	435
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 13, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	435
cagguaaaga gacgaaugat t	21
 
 
<210>	436
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	436
ucauucgucu cuuuaccugt t	21
 
 
<210>	437
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 8, 10, 11, 13, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 7, 9, 12, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	437
cccagcaugc cgcuaucgat t	21
 
 
<210>	438
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 8, 11, 13, 15, 16
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 7, 9, 10, 12, 14, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	438
ucgauagcgg caugcugggt t	21
 
 
<210>	439
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 8, 10, 11, 13, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 7, 9, 12, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	439
cccagcaugc cgcuaucgat t	21
 
 
<210>	440
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 11
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	440
ucgauagcgg caugcugggt t	21
 
 
<210>	441
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 11, 13, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 14, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	441
ggaggacaga uguaccacut t	21
 
 
<210>	442
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 6, 8, 10, 11, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 7, 9, 13
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	442
agugguacau cuguccucct t	21
 
 
<210>	443
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 7, 10, 11, 14, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 8, 9, 12, 13, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	443
cauguacgac caauguaaat t	21
 
 
<210>	444
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 14, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	444
uuuacauugg ucguacaugt t	21
 
 
<210>	445
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 6, 7, 8, 10, 13, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 9, 11, 12, 14, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	445
uaguuccugc aacguuacct t	21
 
 
<210>	446
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 6, 8, 9, 11, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 7, 10, 12, 13, 14, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	446
gguaacguug caggaacuat t	21
 
 
<210>	447
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 9, 10, 11, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 8, 12, 13, 14, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	447
aacuuacacc uggaugacct t	21
 
 
<210>	448
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 7, 8, 12, 14, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 9, 10, 11, 13, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	448
ggucauccag guguaaguut t	21
 
 
<210>	449
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 7, 10, 11, 12, 13, 14, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 8, 9, 15, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	449
aaacaauagu uccugcaact t	21
 
 
<210>	450
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 12
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	450
guugcaggaa cuauuguuut t	21
 
 
<210>	451
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 11, 13, 14, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 8, 9, 10, 12, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	451
uuuuaccgga cacuaaacct t	21
 
 
<210>	452
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 8, 10, 11, 12, 15
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 7, 9, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	452
gguuuagugu ccgguaaaat t	21
 
 
<210>	453
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 7, 8, 11, 12, 14, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 6, 9, 10, 13, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	453
ugagaguugg uuacucacat t	21
 
 
<210>	454
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 7, 10, 11, 14, 15, 16, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 8, 9, 12, 13, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	454
ugugaguaac caacucucat t	21
 
 
<210>	455
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 5, 8, 9, 10, 11, 12, 14, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 7, 13, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	455
acaauaguuc cugcaacgut t	21
 
 
<210>	456
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	456
acguugcagg aacuauugut t	21
 
 
<210>	457
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 8, 9, 14, 15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 10, 11, 12, 13, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	457
gguccaccca ggauuagugt t	21
 
 
<210>	458
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 7, 8, 9, 10, 14, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 11, 12, 13, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	458
cacuaauccu ggguggacct t	21
 
 
<210>	459
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 8, 10, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 7, 9, 11, 12, 13, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	459
uguuauaugc aggauaugat t	21
 
 
<210>	460
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 11, 13, 15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	460
ucauauccug cauauaacat t	21
 
 
<210>	461
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 7, 8, 12, 14, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 9, 10, 11, 13, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	461
augagaccag auguaagcut t	21
 
 
<210>	462
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 9, 10, 11, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 8, 12, 13, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	462
agcuuacauc uggucucaut t	21
 
 
<210>	463
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 8, 12, 13, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 6, 7, 9, 10, 11, 14, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	463
accucaauag gucgaccagt t	21
 
 
<210>	464
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 6, 9, 10, 11, 13, 14, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 7, 8, 12, 15, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	464
cuggucgacc uauugaggut t	21
 
 
<210>	465
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 8, 9, 10, 12, 13, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 11, 14, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	465
agaagauuuc aucgaacuct t	21
 
 
<210>	466
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1..19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	466
gaguucgaug aaaucuucut t	21
 
 
<210>	467
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 7, 10, 14, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 8, 9, 11, 12, 13, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	467
aaaccucaau aggucgacct t	21
 
 
<210>	468
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	9
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	468
ggucgaccua uugagguuut t	21
 
 
<210>	469
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 10, 11, 12, 13, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 8, 9, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	469
uuccaccaau ucccguuggt t	21
 
 
<210>	470
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 11, 12, 15
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 7, 8, 9, 10, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	470
ccaacgggaa uugguggaat t	21
 
 
<210>	471
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 9, 12, 13, 14, 15, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 7, 8, 10, 11, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	471
ugaccaaaug acccuacugt t	21
 
 
<210>	472
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 10, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	472
caguaggguc auuuggucat t	21
 
 
<210>	473
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 7, 8, 11, 12, 13, 14, 15, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 6, 9, 10, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	473
auuccaccaa uucccguugt t	21
 
 
<210>	474
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2..19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	474
caacgggaau ugguggaaut t	21
 
 
<210>	475
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 6, 8, 9, 10, 15, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 7, 11, 12, 13, 14, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	475
ugguccaccc aggauuagut t	21
 
 
<210>	476
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 7, 8, 9, 13, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 10, 11, 12, 14, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	476
acuaauccug gguggaccat t	21
 
 
<210>	477
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 7, 8, 11, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 9, 10, 12, 13, 14, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	477
aggaauucag caggccacut t	21
 
 
<210>	478
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1..19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	478
aguggccugc ugaauuccut t	21
 
 
<210>	479
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 6, 7, 8, 11, 12, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 9, 10, 13, 14, 15, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	479
acuucccugg ucgaacagut t	21
 
 
<210>	480
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 7, 10, 11, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 4, 8, 9, 12, 13, 14, 15, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	480
acuguucgac cagggaagut t	21
 
 
<210>	481
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 11, 13, 14, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 8, 9, 10, 12, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	481
uuuuaccgga cacuaaacct t	21
 
 
<210>	482
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	482
gguuuagugu ccgguaaaat t	21
 
 
<210>	483
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 7, 8, 9, 11, 12, 13, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 10, 14, 15, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	483
aaauaacuug cuuaacuact t	21
 
 
<210>	484
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 6, 10, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	484
guaguuaagc aaguuauuut t	21
 
 
<210>	485
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 6, 7, 10, 14, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 8, 9, 11, 12, 13, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	485
aaggcucagu aagcaaugct t	21
 
 
<210>	486
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 7, 8, 9, 11, 12, 16, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 10, 13, 14, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	486
gcauugcuua cugagccuut t	21
 
 
<210>	487
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 7, 8, 11, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 9, 10, 12, 13, 14, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	487
aggaauucag caggccacut t	21
 
 
<210>	488
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 6, 7, 8, 10, 11, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 9, 12, 13, 14
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	488
aguggccugc ugaauuccut t	21
 
 
<210>	489
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 8, 9, 10, 11, 12, 13, 14, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 6, 7, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	489
cucugaacuu cccuggucgt t	21
 
 
<210>	490
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	490
cgaccaggga aguucagagt t	21
 
 
<210>	491
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 10, 11, 13, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 7, 8, 9, 12, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	491
ucaaugggac uguauauggt t	21
 
 
<210>	492
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 8, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 7, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	492
ccauauacag ucccauugat t	21
 
 
<210>	493
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 9, 11, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 7, 8, 10, 12, 13, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	493
aaacugggca caguuuacut t	21
 
 
<210>	494
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	494
aguaaacugu gcccaguuut t	21
 
 
<210>	495
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 10, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	495
aagccucuca uuuuaccggt t	21
 
 
<210>	496
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 10, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	496
ccgguaaaau gagaggcuut t	21
 
 
<210>	497
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 6, 7, 8, 11, 12, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 9, 10, 13, 14, 15, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	497
acuucccugg ucgaacagut t	21
 
 
<210>	498
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	11
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	498
acuguucgac cagggaagut t	21
 
 
<210>	499
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 9, 10, 11, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 8, 12, 13, 14, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	499
aacuuacacc uggaugacct t	21
 
 
<210>	500
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 8, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	500
ggucauccag guguaaguut t	21
 
 
<210>	501
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 11, 13, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 14, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	501
ggaggacaga uguaccacut t	21
 
 
<210>	502
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 8
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	502
agugguacau cuguccucct t	21
 
 
<210>	503
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 8, 9, 14, 15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 10, 11, 12, 13, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	503
gguccaccca ggauuagugt t	21
 
 
<210>	504
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	504
cacuaauccu ggguggacct t	21
 
 
<210>	505
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 6, 7, 10, 14, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 8, 9, 11, 12, 13, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	505
aaggcucagu aagcaaugct t	21
 
 
<210>	506
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 9
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	506
gcauugcuua cugagccuut t	21
 
 
<210>	507
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 10, 11, 12, 13, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 8, 9, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	507
uuccaccaau ucccguuggt t	21
 
 
<210>	508
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	508
ccaacgggaa uugguggaat t	21
 
 
<210>	509
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 10, 12, 13, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 7, 8, 9, 11, 14, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	509
uuuaccggac acuaaaccct t	21
 
 
<210>	510
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	510
ggguuuagug uccgguaaat t	21
 
 
<210>	511
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 6, 8, 9, 10, 15, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 7, 11, 12, 13, 14, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	511
ugguccaccc aggauuagut t	21
 
 
<210>	512
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	512
acuaauccug gguggaccat t	21
 
 
<210>	513
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 10, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	513
aagccucuca uuuuaccggt t	21
 
 
<210>	514
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	514
ccgguaaaau gagaggcuut t	21
 
 
<210>	515
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 7, 8, 9, 11, 12, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 10, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	515
aggcuuuuca uuaaaugggt t	21
 
 
<210>	516
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 7
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	516
cccauuuaau gaaaagccut t	21
 
 
<210>	517
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 8, 10, 11, 12, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 7, 9, 13, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	517
ugaacuaugc uugcucguut t	21
 
 
<210>	518
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 11, 13, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	518
aacgagcaag cauaguucat t	21
 
 
<210>	519
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 6, 8, 11, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 7, 9, 10, 12
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	519
augaauacag caucccuuut t	21
 
 
<210>	520
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	13, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	520
aaagggaugc uguauucaut t	21
 
 
<210>	521
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 9, 13, 14, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	6, 7, 8, 10, 11, 12, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	521
uucucaggca gauuccaagt t	21
 
 
<210>	522
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1..19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	522
cuuggaaucu gccugagaat t	21
 
 
<210>	523
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 9, 10, 11, 12, 13, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 7, 8, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	523
aacauuaauu uccgugugat t	21
 
 
<210>	524
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 13
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	524
ucacacggaa auuaauguut t	21
 
 
<210>	525
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 7, 9, 10, 11, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 8, 12, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	525
gaacuaugcu ugcucguuut t	21
 
 
<210>	526
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	8, 12, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	526
aaacgagcaa gcauaguuct t	21
 
 
<210>	527
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 8, 10, 11, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 6, 7, 9, 12, 13, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	527
uccuagacgc uaacauuaat t	21
 
 
<210>	528
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 8, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	528
uuaauguuag cgucuaggat t	21
 
 
<210>	529
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 6, 7, 9, 10, 11, 12, 14, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 5, 8, 13, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	529
uaaugucauu ccaccaauut t	21
 
 
<210>	530
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	530
aauuggugga augacauuat t	21
 
 
<210>	531
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 9, 10, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 8, 11, 12, 13, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	531
uuauuuuacc ggacacuaat t	21
 
 
<210>	532
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 12, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	532
uuaguguccg guaaaauaat t	21
 
 
<210>	533
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 9, 10, 11, 12, 13, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 7, 8, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	533
aacauuaauu uccgugugat t	21
 
 
<210>	534
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 6, 12, 13, 16, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 5, 7, 8, 9, 10, 11, 14, 15, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	534
ucacacggaa auuaauguut t	21
 
 
<210>	535
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 12, 13
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 7, 8, 9, 10, 11, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	535
auaucaaaga gcuaggaaat t	21
 
 
<210>	536
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	536
uuuccuagcu cuuugauaut t	21
 
 
<210>	537
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 9, 11, 12, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 7, 8, 10, 13, 14
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	537
gacgcuaaca uuaauuucct t	21
 
 
<210>	538
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 13
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	538
ggaaauuaau guuagcguct t	21
 
 
<210>	539
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 8, 14, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 7, 9, 10, 11, 12, 13, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	539
uuccguguga aaauggguct t	21
 
 
<210>	540
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 11, 13
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	540
gacccauuuu cacacggaat t	21
 
 
<210>	541
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 6, 7, 9, 11, 12, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 8, 10, 14, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	541
gugaacuaug cuugcucgut t	21
 
 
<210>	542
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 10, 12, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 11, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	542
acgagcaagc auaguucact t	21
 
 
<210>	543
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 12, 13
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 7, 8, 9, 10, 11, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	543
auaucaaaga gcuaggaaat t	21
 
 
<210>	544
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	7, 8, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	544
uuuccuagcu cuuugauaut t	21
 
 
<210>	545
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 8, 10, 11, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 6, 7, 9, 12, 13, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	545
uccuagacgc uaacauuaat t	21
 
 
<210>	546
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 8, 11, 13, 14, 15
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 9, 10, 12, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	546
uuaauguuag cgucuaggat t	21
 
 
<210>	547
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 7, 9, 12, 13, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 8, 10, 11, 14, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	547
ugcauguaug accaauguat t	21
 
 
<210>	548
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 6, 9, 10, 12, 14, 16, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 7, 8, 11, 13, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	548
uacauugguc auacaugcat t	21
 
 
<210>	549
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 9, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	7, 8, 10, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	549
cccccuggua gagacgaagt t	21
 
 
<210>	550
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 8, 9, 10, 12, 13, 14
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 7, 11, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	550
cuuggaaucu gccugagaat t	21
 
 
<210>	551
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 8, 11, 13, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 7, 9, 10, 12, 14, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	551
uuuaucauga cauguuauat t	21
 
 
<210>	552
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 11, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	552
uauaacaugu caugauaaat t	21
 
 
<210>	553
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 9, 13, 14, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 7, 8, 10, 11, 12, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	553
aaccucaaua ggucgaccat t	21
 
 
<210>	554
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	10
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	554
uggucgaccu auugagguut t	21
 
 
<210>	555
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 11, 12, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 7, 8, 9, 10, 13, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	555
uuauccaaag ccguuucact t	21
 
 
<210>	556
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	556
gugaaacggc uuuggauaat t	21
 
 
<210>	557
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 8, 14, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 7, 9, 10, 11, 12, 13, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	557
uuccguguga aaauggguct t	21
 
 
<210>	558
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 8, 9, 10, 11, 13, 15
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 12, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	558
gacccauuuu cacacggaat t	21
 
 
<210>	559
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 8, 12, 13, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 6, 7, 9, 10, 11, 14, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	559
accucaauag gucgaccagt t	21
 
 
<210>	560
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	11
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	560
cuggucgacc uauugaggut t	21
 
 
<210>	561
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 7, 9, 10, 11, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 8, 12, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	561
gaacuaugcu ugcucguuut t	21
 
 
<210>	562
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 8, 12, 14, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 9, 10, 11, 13, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	562
aaacgagcaa gcauaguuct t	21
 
 
<210>	563
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 6, 7, 10, 12, 13, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 8, 9, 11, 14, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	563
agacgcuaac auuaauuuct t	21
 
 
<210>	564
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 6, 9, 11, 12, 15, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 7, 8, 10, 13, 14, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	564
gaaauuaaug uuagcgucut t	21
 
 
<210>	565
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 8, 11, 13, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 7, 9, 10, 12, 14, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	565
uuuaucauga cauguuauat t	21
 
 
<210>	566
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 8, 10, 11, 13, 16
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 7, 9, 12, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	566
uauaacaugu caugauaaat t	21
 
 
<210>	567
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 6, 7, 9, 11, 12, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 8, 10, 14, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	567
gugaacuaug cuugcucgut t	21
 
 
<210>	568
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 6, 10, 12, 15, 16, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 7, 8, 9, 11, 13, 14, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	568
acgagcaagc auaguucact t	21
 
 
<210>	569
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 6, 7, 10, 12, 13, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 8, 9, 11, 14, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	569
agacgcuaac auuaauuuct t	21
 
 
<210>	570
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 12
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	570
gaaauuaaug uuagcgucut t	21
 
 
<210>	571
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 8, 9, 13, 14, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 10, 11, 12, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	571
ccggacacua aaccuaaaat t	21
 
 
<210>	572
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 8, 9, 10, 13, 15, 16, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 6, 7, 11, 12, 14, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	572
uuuuagguuu aguguccggt t	21
 
 
<210>	573
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 7, 8, 9, 10, 13, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 11, 12, 14, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	573
ugcaaaccuc aauaggucgt t	21
 
 
<210>	574
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	574
cgaccuauug agguuugcat t	21
 
 
<210>	575
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 8, 9, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 7, 10, 11, 12, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	575
cugaaaacug gaauaggugt t	21
 
 
<210>	576
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 7, 8, 9, 10, 13, 14, 15, 16, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 6, 11, 12, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	576
caccuauucc aguuuucagt t	21
 
 
<210>	577
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 8, 11, 12, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 7, 9, 10, 13, 14, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	577
uguuauaugg uuaaacccat t	21
 
 
<210>	578
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 11, 13, 15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	578
uggguuuaac cauauaacat t	21
 
 
<210>	579
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 6, 8, 11, 12, 16, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 7, 9, 10, 13, 14, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	579
uguuauaugg uuaaacccat t	21
 
 
<210>	580
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 7, 10, 11, 13, 15, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 8, 9, 12, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	580
uggguuuaac cauauaacat t	21
 
 
<210>	581
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 6, 10, 11, 14, 15, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 7, 8, 9, 12, 13, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	581
ugguuuaaau uggucucaat t	21
 
 
<210>	582
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 7, 8, 11, 12, 13, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 9, 10, 14, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	582
uugagaccaa uuuaaaccat t	21
 
 
<210>	583
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 8, 9, 13, 14, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 7, 10, 11, 12, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	583
ccggacacua aaccuaaaat t	21
 
 
<210>	584
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 10
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	584
uuuuagguuu aguguccggt t	21
 
 
<210>	585
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 8, 10, 11, 12, 13, 15, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 9, 14, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	585
uuaaugucau uccaccaaut t	21
 
 
<210>	586
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 11, 14, 16, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 7, 8, 9, 10, 12, 13, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	586
auugguggaa ugacauuaat t	21
 
 
<210>	587
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 9, 10, 11, 15, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 7, 8, 12, 13, 14, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	587
uguaaugguu uaaauuggut t	21
 
 
<210>	588
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 7, 8, 12, 13, 15, 16, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 9, 10, 11, 14, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	588
accaauuuaa accauuacat t	21
 
 
<210>	589
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 6, 10, 11, 14, 15, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 7, 8, 9, 12, 13, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	589
ugguuuaaau uggucucaat t	21
 
 
<210>	590
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	8, 13, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	590
uugagaccaa uuuaaaccat t	21
 
 
<210>	591
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 7, 9, 10, 13, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 8, 11, 12, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	591
uuuaauuacu gguaggacat t	21
 
 
<210>	592
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 9, 12, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 10, 11, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	592
uguccuacca guaauuaaat t	21
 
 
<210>	593
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 9, 11, 12, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 7, 8, 10, 13, 14
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	593
gacgcuaaca uuaauuucct t	21
 
 
<210>	594
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 7, 10, 12, 13, 16, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 8, 9, 11, 14, 15, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	594
ggaaauuaau guuagcguct t	21
 
 
<210>	595
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 9, 10, 14, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 8, 11, 12, 13, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	595
uuauuuuacc ggacacuaat t	21
 
 
<210>	596
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 8, 9, 12, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 10, 11, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	596
uuaguguccg guaaaauaat t	21
 
 
<210>	597
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 11, 12, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 7, 8, 9, 10, 13, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	597
uuauccaaag ccguuucact t	21
 
 
<210>	598
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 7, 10, 11, 12, 13, 17
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 8, 9, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	598
gugaaacggc uuuggauaat t	21
 
 
<210>	599
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 10, 12, 13, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 7, 8, 9, 11, 14, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	599
uuuaccggac acuaaaccut t	21
 
 
<210>	600
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	6, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	600
agguuuagug uccgguaaat t	21
 
 
<210>	601
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 6, 7, 9, 10, 13, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 8, 11, 12, 14, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	601
uuuaauuacu gguaggacat t	21
 
 
<210>	602
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 8, 9, 12, 15, 16
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 7, 10, 11, 13, 14, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	602
uguccuacca guaauuaaat t	21
 
 
<210>	603
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 6, 8, 10, 11, 12, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 7, 9, 13, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	603
ugaacuaugc uugcucguut t	21
 
 
<210>	604
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 7, 11, 13, 16, 17, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 8, 9, 10, 12, 14, 15, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	604
aacgagcaag cauaguucat t	21
 
 
<210>	605
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 9, 10, 13, 14, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 7, 8, 11, 12, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	605
gguuuaaauu ggucucaaat t	21
 
 
<210>	606
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	9, 14
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	606
uuugagacca auuuaaacct t	21
 
 
<210>	607
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 9, 10, 13, 14, 15, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 6, 7, 8, 11, 12, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	607
gguuuaaauu ggucucaaat t	21
 
 
<210>	608
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 8, 9, 12, 13, 14, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 7, 10, 11, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	608
uuugagacca auuuaaacct t	21
 
 
<210>	609
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 8, 11, 12, 13, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 7, 9, 10, 14, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	609
ugcugaauaa ccuguaguut t	21
 
 
<210>	610
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 6, 11, 15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 7, 8, 9, 10, 12, 13, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	610
aacuacaggu uauucagcat t	21
 
 
<210>	611
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 8, 14, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	611
aaaugggcaa aggcgauact t	21
 
 
<210>	612
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 7, 8, 9, 10, 11, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 12, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	612
guaucgccuu ugcccauuut t	21
 
 
<210>	613
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 9, 10, 11, 15, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 7, 8, 12, 13, 14, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	613
uguaaugguu uaaauuggut t	21
 
 
<210>	614
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 8, 13, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 14, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	614
accaauuuaa accauuacat t	21
 
 
<210>	615
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 6, 8, 11, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 7, 9, 10, 12
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	615
augaauacag caucccuuut t	21
 
 
<210>	616
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	8, 10, 11, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 9, 12, 14, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	616
aaagggaugc uguauucaut t	21
 
 
<210>	617
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 7, 8, 11, 12, 14, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 9, 10, 13, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	617
uguuagucag ccauuuacat t	21
 
 
<210>	618
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 7, 10, 11, 14, 15, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 8, 9, 12, 13, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	618
uguaaauggc ugacuaacat t	21
 
 
<210>	619
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 8, 10, 11, 12, 13, 15, 16, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 9, 14, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	619
uuaaugucau uccaccaaut t	21
 
 
<210>	620
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	14, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	620
auugguggaa ugacauuaat t	21
 
 
<210>	621
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 7, 8, 9, 10, 12, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 6, 11, 13, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	621
guguggcuuc auaccguuct t	21
 
 
<210>	622
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 7, 9, 14, 15, 17, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 8, 10, 11, 12, 13, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	622
gaacgguaug aagccacact t	21
 
 
<210>	623
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 4, 7, 8, 9, 10, 12, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 6, 11, 13, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	623
guguggcuuc auaccguuct t	21
 
 
<210>	624
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 15, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	624
gaacgguaug aagccacact t	21
 
 
<210>	625
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 7, 8, 11, 12, 14, 15, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 9, 10, 13, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	625
uguuagucag ccauuuacat t	21
 
 
<210>	626
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 15, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	626
uguaaauggc ugacuaacat t	21
 
 
<210>	627
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 7, 8, 9, 11, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 10, 12, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	627
uguggcuuca uaccguucct t	21
 
 
<210>	628
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	8, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	628
ggaacgguau gaagccacat t	21
 
 
<210>	629
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 8, 11, 12, 13, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 5, 6, 7, 9, 10, 14, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	629
ugcugaauaa ccuguaguut t	21
 
 
<210>	630
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 6, 10, 11, 13, 14, 15, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 7, 8, 9, 12, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	630
aacuacaggu uauucagcat t	21
 
 
<210>	631
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 10, 12, 13, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 7, 8, 9, 11, 14, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	631
uuuaccggac acuaaaccut t	21
 
 
<210>	632
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 9, 11, 12, 13, 16
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 7, 8, 10, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	632
agguuuagug uccgguaaat t	21
 
 
<210>	633
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 8, 9, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 7, 10, 11, 12, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	633
cugaaaacug gaauaggugt t	21
 
 
<210>	634
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 5, 10, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	634
caccuauucc aguuuucagt t	21
 
 
<210>	635
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 7, 10, 14, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 8, 9, 11, 12, 13, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	635
aaaccucaau aggucgacct t	21
 
 
<210>	636
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 7, 8, 9, 11, 12, 17, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 6, 10, 13, 14, 15, 16
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	636
ggucgaccua uugagguuut t	21
 
 
<210>	637
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 4, 5, 6, 9, 13, 14, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 7, 8, 10, 11, 12, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	637
aaccucaaua ggucgaccat t	21
 
 
<210>	638
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 8, 9, 10, 12, 13, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 7, 11, 14, 15, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	638
uggucgaccu auugagguut t	21
 
 
<210>	639
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 7, 9, 10, 13, 14, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 8, 11, 12, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	639
aguaaauguu agucagccat t	21
 
 
<210>	640
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 8, 9, 12, 14, 15, 16, 18, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 6, 7, 10, 11, 13, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	640
uggcugacua acauuuacut t	21
 
 
<210>	641
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 5, 7, 9, 12, 13, 16, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 6, 8, 10, 11, 14, 15, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	641
ugcauguaug accaauguat t	21
 
 
<210>	642
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 10, 12, 14, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 7, 8, 9, 11, 13, 15, 16, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	642
uacauugguc auacaugcat t	21
 
 
<210>	643
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 7, 8, 9, 10, 13, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 6, 11, 12, 14, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	643
ugcaaaccuc aauaggucgt t	21
 
 
<210>	644
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 4, 5, 6, 8, 9, 14, 15, 16, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 3, 7, 10, 11, 12, 13, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	644
cgaccuauug agguuugcat t	21
 
 
<210>	645
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 5, 6, 7, 10, 14, 15, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 8, 9, 11, 12, 13, 16, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	645
aaaccucaau aggucgacct t	21
 
 
<210>	646
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	9
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	646
ggucgaccua uugagguuut t	21
 
 
<210>	647
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 7, 9, 10, 13, 14, 17, 18
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 5, 6, 8, 11, 12, 15, 16, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	647
aguaaauguu agucagccat t	21
 
 
<210>	648
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	9, 12, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	648
uggcugacua acauuuacut t	21
 
 
<210>	649
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 10, 13, 14, 15, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	649
ucuuauuuua ccggacacut t	21
 
 
<210>	650
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	10, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	650
aguguccggu aaaauaagat t	21
 
 
<210>	651
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 3, 4, 5, 8, 12, 13, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 6, 7, 9, 10, 11, 14, 15, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	651
accucaauag gucgaccagt t	21
 
 
<210>	652
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 5, 6, 9, 10, 11, 13, 14, 19
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	3, 4, 7, 8, 12, 15, 16, 17, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	652
cuggucgacc uauugaggut t	21
 
 
<210>	653
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	4, 8, 14, 17, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, 18
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	653
aaaugggcaa aggcgauact t	21
 
 
<210>	654
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	2, 15
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	654
guaucgccuu ugcccauuut t	21
 
 
<210>	655
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 3, 6, 7, 8, 9, 11, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	2, 4, 5, 10, 12, 15
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	655
uguggcuuca uaccguucct t	21
 
 
<210>	656
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	5, 8, 10, 15, 16, 18
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 9, 11, 12, 13, 14, 17, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	656
ggaacgguau gaagccacat t	21
 
 
<210>	657
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 16, 18, 19
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	5, 10, 13, 14, 15, 17
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	657
ucuuauuuua ccggacacut t	21
 
 
<210>	658
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	3, 5, 6, 7, 10, 15
<223>	/mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 4, 8, 9, 11, 12, 13, 14, 16, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	658
aguguccggu aaaauaagat t	21
 
 
<210>	659
<211>	6784
<212>	DNA
<213>	Homo sapiens
 
<220>
<223>	cDNA sequence of human NR3C1 

<300>
<308>	NM_000176.2
<309>	2009-04-05	
 
<400>	659
ggcgccgcctccacccgctccccgctcggtcccgctcgctcgcccaggccgggctgccct	60
ttcgcgtgtccgcgctctcttccctccgccgccgcctcctccattttgcgagctcgtgtc	120
tgtgacgggagcccgagtcaccgcctgcccgtcggggacggattctgtgggtggaaggag	180
acgccgcagccggagcggccgaagcagctgggaccgggacggggcacgcgcgcccggaac	240
ctcgacccgcggagcccggcgcggggcggagggctggcttgtcagctgggcaatgggaga	300
ctttcttaaataggggctctccccccacccatggagaaaggggcggctgtttacttcctt	360
tttttagaaaaaaaaaatatatttccctcctgctccttctgcgttcacaagctaagttgt	420
ttatctcggctgcggcgggaactgcggacggtggcgggcgagcggctcctctgccagagt	480
tgatattcactgatggactccaaagaatcattaactcctggtagagaagaaaaccccagc	540
agtgtgcttgctcaggagaggggagatgtgatggacttctataaaaccctaagaggagga	600
gctactgtgaaggtttctgcgtcttcaccctcactggctgtcgcttctcaatcagactcc	660
aagcagcgaagacttttggttgattttccaaaaggctcagtaagcaatgcgcagcagcca	720
gatctgtccaaagcagtttcactctcaatgggactgtatatgggagagacagaaacaaaa	780
gtgatgggaaatgacctgggattcccacagcagggccaaatcagcctttcctcgggggaa	840
acagacttaaagcttttggaagaaagcattgcaaacctcaataggtcgaccagtgttcca	900
gagaaccccaagagttcagcatccactgctgtgtctgctgcccccacagagaaggagttt	960
ccaaaaactcactctgatgtatcttcagaacagcaacatttgaagggccagactggcacc	1020
aacggtggcaatgtgaaattgtataccacagaccaaagcacctttgacattttgcaggat	1080
ttggagttttcttctgggtccccaggtaaagagacgaatgagagtccttggagatcagac	1140
ctgttgatagatgaaaactgtttgctttctcctctggcgggagaagacgattcattcctt	1200
ttggaaggaaactcgaatgaggactgcaagcctctcattttaccggacactaaacccaaa	1260
attaaggataatggagatctggttttgtcaagccccagtaatgtaacactgccccaagtg	1320
aaaacagaaaaagaagatttcatcgaactctgcacccctggggtaattaagcaagagaaa	1380
ctgggcacagtttactgtcaggcaagctttcctggagcaaatataattggtaataaaatg	1440
tctgccatttctgttcatggtgtgagtacctctggaggacagatgtaccactatgacatg	1500
aatacagcatccctttctcaacagcaggatcagaagcctatttttaatgtcattccacca	1560
attcccgttggttccgaaaattggaataggtgccaaggatctggagatgacaacttgact	1620
tctctggggactctgaacttccctggtcgaacagttttttctaatggctattcaagcccc	1680
agcatgagaccagatgtaagctctcctccatccagctcctcaacagcaacaacaggacca	1740
cctcccaaactctgcctggtgtgctctgatgaagcttcaggatgtcattatggagtctta	1800
acttgtggaagctgtaaagttttcttcaaaagagcagtggaaggacagcacaattaccta	1860
tgtgctggaaggaatgattgcatcatcgataaaattcgaagaaaaaactgcccagcatgc	1920
cgctatcgaaaatgtcttcaggctggaatgaacctggaagctcgaaaaacaaagaaaaaa	1980
ataaaaggaattcagcaggccactacaggagtctcacaagaaacctctgaaaatcctggt	2040
aacaaaacaatagttcctgcaacgttaccacaactcacccctaccctggtgtcactgttg	2100
gaggttattgaacctgaagtgttatatgcaggatatgatagctctgttccagactcaact	2160
tggaggatcatgactacgctcaacatgttaggagggcggcaagtgattgcagcagtgaaa	2220
tgggcaaaggcaataccaggtttcaggaacttacacctggatgaccaaatgaccctactg	2280
cagtactcctggatgtttcttatggcatttgctctggggtggagatcatatagacaatca	2340
agtgcaaacctgctgtgttttgctcctgatctgattattaatgagcagagaatgactcta	2400
ccctgcatgtacgaccaatgtaaacacatgctgtatgtttcctctgagttacacaggctt	2460
caggtatcttatgaagagtatctctgtatgaaaaccttactgcttctctcttcagttcct	2520
aaggacggtctgaagagccaagagctatttgatgaaattagaatgacctacatcaaagag	2580
ctaggaaaagccattgtcaagagggaaggaaactccagccagaactggcagcggttttat	2640
caactgacaaaactcttggattctatgcatgaagtggttgaaaatctccttaactattgc	2700
ttccaaacatttttggataagaccatgagtattgaattccccgagatgttagctgaaatc	2760
atcaccaatcagataccaaaatattcaaatggaaatatcaaaaaacttctgtttcatcaa	2820
aagtgactgccttaataagaatggttgccttaaagaaagtcgaattaatagcttttattg	2880
tataaactatcagtttgtcctgtagaggttttgttgttttattttttattgttttcatct	2940
gttgttttgttttaaatacgcactacatgtggtttatagagggccaagacttggcaacag	3000
aagcagttgagtcgtcatcacttttcagtgatgggagagtagatggtgaaatttattagt	3060
taatatatcccagaaattagaaaccttaatatgtggacgtaatctccacagtcaaagaag	3120
gatggcacctaaaccaccagtgcccaaagtctgtgtgatgaactttctcttcatactttt	3180
tttcacagttggctggatgaaattttctagactttctgttggtgtatcccccccctgtat	3240
agttaggatagcatttttgatttatgcatggaaacctgaaaaaaagtttacaagtgtata	3300
tcagaaaagggaagttgtgccttttatagctattactgtctggttttaacaatttccttt	3360
atatttagtgaactacgcttgctcattttttcttacataattttttattcaagttattgt	3420
acagctgtttaagatgggcagctagttcgtagctttcccaaataaactctaaacattaat	3480
caatcatctgtgtgaaaatgggttggtgcttctaacctgatggcacttagctatcagaag	3540
accacaaaaattgactcaaatctccagtattcttgtcaaaaaaaaaaaaaaaaaagctca	3600
tattttgtatatatctgcttcagtggagaattatataggttgtgcaaattaacagtccta	3660
actggtatagagcacctagtccagtgacctgctgggtaaactgtggatgatggttgcaaa	3720
agactaatttaaaaaataactaccaagaggccctgtctgtacctaacgccctatttttgc	3780
aatggctatatggcaagaaagctggtaaactatttgtctttcaggaccttttgaagtagt	3840
ttgtataacttcttaaaagttgtgattccagataaccagctgtaacacagctgagagact	3900
tttaatcagacaaagtaattcctctcactaaactttacccaaaaactaaatctctaatat	3960
ggcaaaaatggctagacacccattttcacattcccatctgtcaccaattggttaatcttt	4020
cctgatggtacaggaaagctcagctactgatttttgtgatttagaactgtatgtcagaca	4080
tccatgtttgtaaaactacacatccctaatgtgtgccatagagtttaacacaagtcctgt	4140
gaatttcttcactgttgaaaattattttaaacaaaatagaagctgtagtagccctttctg	4200
tgtgcaccttaccaactttctgtaaactcaaaacttaacatatttactaagccacaagaa	4260
atttgatttctattcaaggtggccaaattatttgtgtaatagaaaactgaaaatctaata	4320
ttaaaaatatggaacttctaatatatttttatatttagttatagtttcagatatatatca	4380
tattggtattcactaatctgggaagggaagggctactgcagctttacatgcaatttatta	4440
aaatgattgtaaaatagcttgtatagtgtaaaataagaatgatttttagatgagattgtt	4500
ttatcatgacatgttatatattttttgtaggggtcaaagaaatgctgatggataacctat	4560
atgatttatagtttgtacatgcattcatacaggcagcgatggtctcagaaaccaaacagt	4620
ttgctctaggggaagagggagatggagactggtcctgtgtgcagtgaaggttgctgaggc	4680
tctgacccagtgagattacagaggaagttatcctctgcctcccattctgaccacccttct	4740
cattccaacagtgagtctgtcagcgcaggtttagtttactcaatctccccttgcactaaa	4800
gtatgtaaagtatgtaaacaggagacaggaaggtggtgcttacatccttaaaggcaccat	4860
ctaatagcgggttactttcacatacagccctcccccagcagttgaatgacaacagaagct	4920
tcagaagtttggcaatagtttgcatagaggtaccagcaatatgtaaatagtgcagaatct	4980
cataggttgccaataatacactaattcctttctatcctacaacaagagtttatttccaaa	5040
taaaatgaggacatgtttttgttttctttgaatgctttttgaatgttatttgttattttc	5100
agtattttggagaaattatttaataaaaaaacaatcatttgctttttgaatgctctctaa	5160
aagggaatgtaatattttaagatggtgtgtaacccggctggataaatttttggtgcctaa	5220
gaaaactgcttgaatattcttatcaatgacagtgttaagtttcaaaaagagcttctaaaa	5280
cgtagattatcattcctttatagaatgttatgtggttaaaaccagaaagcacatctcaca	5340
cattaatctgattttcatcccaacaatcttggcgctcaaaaaatagaactcaatgagaaa	5400
aagaagattatgtgcacttcgttgtcaataataagtcaactgatgctcatcgacaactat	5460
aggaggcttttcattaaatgggaaaagaagctgtgcccttttaggatacgtgggggaaaa	5520
gaaagtcatcttaattatgtttaattgtggatttaagtgctatatggtggtgctgtttga	5580
aagcagatttatttcctatgtatgtgttatctggccatcccaacccaaactgttgaagtt	5640
tgtagtaacttcagtgagagttggttactcacaacaaatcctgaaaagtatttttagtgt	5700
ttgtaggtattctgtgggatactatacaagcagaactgaggcacttaggacataacactt	5760
ttggggtatatatatccaaatgcctaaaactatgggaggaaaccttggccaccccaaaag	5820
gaaaactaacatgatttgtgtctatgaagtgctggataattagcatgggatgagctctgg	5880
gcatgccatgaaggaaagccacgctcccttcagaattcagaggcagggagcaattccagt	5940
ttcacctaagtctcataattttagttcccttttaaaaaccctgaaaactacatcaccatg	6000
gaatgaaaaatattgttatacaatacattgatctgtcaaacttccagaaccatggtagcc	6060
ttcagtgagatttccatcttggctggtcactccctgactgtagctgtaggtgaatgtgtt	6120
tttgtgtgtgtgtgtctggttttagtgtcagaagggaaataaaagtgtaaggaggacact	6180
ttaaaccctttgggtggagtttcgtaatttcccagactattttcaagcaacctggtccac	6240
ccaggattagtgaccaggttttcaggaaaggatttgcttctctctagaaaatgtctgaaa	6300
ggattttattttctgatgaaaggctgtatgaaaataccctcctcaaataacttgcttaac	6360
tacatatagattcaagtgtgtcaatattctattttgtatattaaatgctatataatgggg	6420
acaaatctatattatactgtgtatggcattattaagaagctttttcattattttttatca	6480
cagtaattttaaaatgtgtaaaaattaaaaccagtgactcctgtttaaaaataaaagttg	6540
tagttttttattcatgctgaataataatctgtagttaaaaaaaaagtgtctttttaccta	6600
cgcagtgaaatgtcagactgtaaaaccttgtgtggaaatgtttaacttttattttttcat	6660
ttaaatttgctgttctggtattaccaaaccacacatttgtaccgaattggcagtaaatgt	6720
tagccatttacagcaatgccaaatatggagaaacatcataataaaaaaatctgctttttc	6780
atta                                                        	6784
 
 
<210>	660
<211>	6614
<212>	DNA
<213>	Homo sapiens
 
<220>
<223>	cDNA sequence of human NR3C1 

<300>
<308>	NM_001018074.1
<309>	2009-04-12
 
<400>	660
aggttatgtaagggtttgctttcaccccattcaaaaggtacctcttcctcttctcttgct	60
ccctctcgccctcattcttgtgcctatgcagacatttgagtagaggcgaatcactttcac	120
ttctgctggggaaattgcaacacgcttctttaaatggcagagagaaggagaaaacttaga	180
tcttctgataccaaatcactggaccttagaaggtcagaaatctttcaagccctgcaggac	240
cgtaaaatgcgcatgtgtccaacggaagcactggggcatgagtggggaaggaatagaaac	300
agaaagaggttgatattcactgatggactccaaagaatcattaactcctggtagagaaga	360
aaaccccagcagtgtgcttgctcaggagaggggagatgtgatggacttctataaaaccct	420
aagaggaggagctactgtgaaggtttctgcgtcttcaccctcactggctgtcgcttctca	480
atcagactccaagcagcgaagacttttggttgattttccaaaaggctcagtaagcaatgc	540
gcagcagccagatctgtccaaagcagtttcactctcaatgggactgtatatgggagagac	600
agaaacaaaagtgatgggaaatgacctgggattcccacagcagggccaaatcagcctttc	660
ctcgggggaaacagacttaaagcttttggaagaaagcattgcaaacctcaataggtcgac	720
cagtgttccagagaaccccaagagttcagcatccactgctgtgtctgctgcccccacaga	780
gaaggagtttccaaaaactcactctgatgtatcttcagaacagcaacatttgaagggcca	840
gactggcaccaacggtggcaatgtgaaattgtataccacagaccaaagcacctttgacat	900
tttgcaggatttggagttttcttctgggtccccaggtaaagagacgaatgagagtccttg	960
gagatcagacctgttgatagatgaaaactgtttgctttctcctctggcgggagaagacga	1020
ttcattccttttggaaggaaactcgaatgaggactgcaagcctctcattttaccggacac	1080
taaacccaaaattaaggataatggagatctggttttgtcaagccccagtaatgtaacact	1140
gccccaagtgaaaacagaaaaagaagatttcatcgaactctgcacccctggggtaattaa	1200
gcaagagaaactgggcacagtttactgtcaggcaagctttcctggagcaaatataattgg	1260
taataaaatgtctgccatttctgttcatggtgtgagtacctctggaggacagatgtacca	1320
ctatgacatgaatacagcatccctttctcaacagcaggatcagaagcctatttttaatgt	1380
cattccaccaattcccgttggttccgaaaattggaataggtgccaaggatctggagatga	1440
caacttgacttctctggggactctgaacttccctggtcgaacagttttttctaatggcta	1500
ttcaagccccagcatgagaccagatgtaagctctcctccatccagctcctcaacagcaac	1560
aacaggaccacctcccaaactctgcctggtgtgctctgatgaagcttcaggatgtcatta	1620
tggagtcttaacttgtggaagctgtaaagttttcttcaaaagagcagtggaaggacagca	1680
caattacctatgtgctggaaggaatgattgcatcatcgataaaattcgaagaaaaaactg	1740
cccagcatgccgctatcgaaaatgtcttcaggctggaatgaacctggaagctcgaaaaac	1800
aaagaaaaaaataaaaggaattcagcaggccactacaggagtctcacaagaaacctctga	1860
aaatcctggtaacaaaacaatagttcctgcaacgttaccacaactcacccctaccctggt	1920
gtcactgttggaggttattgaacctgaagtgttatatgcaggatatgatagctctgttcc	1980
agactcaacttggaggatcatgactacgctcaacatgttaggagggcggcaagtgattgc	2040
agcagtgaaatgggcaaaggcaataccaggtttcaggaacttacacctggatgaccaaat	2100
gaccctactgcagtactcctggatgtttcttatggcatttgctctggggtggagatcata	2160
tagacaatcaagtgcaaacctgctgtgttttgctcctgatctgattattaatgagcagag	2220
aatgactctaccctgcatgtacgaccaatgtaaacacatgctgtatgtttcctctgagtt	2280
acacaggcttcaggtatcttatgaagagtatctctgtatgaaaaccttactgcttctctc	2340
ttcagttcctaaggacggtctgaagagccaagagctatttgatgaaattagaatgaccta	2400
catcaaagagctaggaaaagccattgtcaagagggaaggaaactccagccagaactggca	2460
gcggttttatcaactgacaaaactcttggattctatgcatgaagtggttgaaaatctcct	2520
taactattgcttccaaacatttttggataagaccatgagtattgaattccccgagatgtt	2580
agctgaaatcatcaccaatcagataccaaaatattcaaatggaaatatcaaaaaacttct	2640
gtttcatcaaaagtgactgccttaataagaatggttgccttaaagaaagtcgaattaata	2700
gcttttattgtataaactatcagtttgtcctgtagaggttttgttgttttattttttatt	2760
gttttcatctgttgttttgttttaaatacgcactacatgtggtttatagagggccaagac	2820
ttggcaacagaagcagttgagtcgtcatcacttttcagtgatgggagagtagatggtgaa	2880
atttattagttaatatatcccagaaattagaaaccttaatatgtggacgtaatctccaca	2940
gtcaaagaaggatggcacctaaaccaccagtgcccaaagtctgtgtgatgaactttctct	3000
tcatactttttttcacagttggctggatgaaattttctagactttctgttggtgtatccc	3060
ccccctgtatagttaggatagcatttttgatttatgcatggaaacctgaaaaaaagttta	3120
caagtgtatatcagaaaagggaagttgtgccttttatagctattactgtctggttttaac	3180
aatttcctttatatttagtgaactacgcttgctcattttttcttacataattttttattc	3240
aagttattgtacagctgtttaagatgggcagctagttcgtagctttcccaaataaactct	3300
aaacattaatcaatcatctgtgtgaaaatgggttggtgcttctaacctgatggcacttag	3360
ctatcagaagaccacaaaaattgactcaaatctccagtattcttgtcaaaaaaaaaaaaa	3420
aaaaagctcatattttgtatatatctgcttcagtggagaattatataggttgtgcaaatt	3480
aacagtcctaactggtatagagcacctagtccagtgacctgctgggtaaactgtggatga	3540
tggttgcaaaagactaatttaaaaaataactaccaagaggccctgtctgtacctaacgcc	3600
ctatttttgcaatggctatatggcaagaaagctggtaaactatttgtctttcaggacctt	3660
ttgaagtagtttgtataacttcttaaaagttgtgattccagataaccagctgtaacacag	3720
ctgagagacttttaatcagacaaagtaattcctctcactaaactttacccaaaaactaaa	3780
tctctaatatggcaaaaatggctagacacccattttcacattcccatctgtcaccaattg	3840
gttaatctttcctgatggtacaggaaagctcagctactgatttttgtgatttagaactgt	3900
atgtcagacatccatgtttgtaaaactacacatccctaatgtgtgccatagagtttaaca	3960
caagtcctgtgaatttcttcactgttgaaaattattttaaacaaaatagaagctgtagta	4020
gccctttctgtgtgcaccttaccaactttctgtaaactcaaaacttaacatatttactaa	4080
gccacaagaaatttgatttctattcaaggtggccaaattatttgtgtaatagaaaactga	4140
aaatctaatattaaaaatatggaacttctaatatatttttatatttagttatagtttcag	4200
atatatatcatattggtattcactaatctgggaagggaagggctactgcagctttacatg	4260
caatttattaaaatgattgtaaaatagcttgtatagtgtaaaataagaatgatttttaga	4320
tgagattgttttatcatgacatgttatatattttttgtaggggtcaaagaaatgctgatg	4380
gataacctatatgatttatagtttgtacatgcattcatacaggcagcgatggtctcagaa	4440
accaaacagtttgctctaggggaagagggagatggagactggtcctgtgtgcagtgaagg	4500
ttgctgaggctctgacccagtgagattacagaggaagttatcctctgcctcccattctga	4560
ccacccttctcattccaacagtgagtctgtcagcgcaggtttagtttactcaatctcccc	4620
ttgcactaaagtatgtaaagtatgtaaacaggagacaggaaggtggtgcttacatcctta	4680
aaggcaccatctaatagcgggttactttcacatacagccctcccccagcagttgaatgac	4740
aacagaagcttcagaagtttggcaatagtttgcatagaggtaccagcaatatgtaaatag	4800
tgcagaatctcataggttgccaataatacactaattcctttctatcctacaacaagagtt	4860
tatttccaaataaaatgaggacatgtttttgttttctttgaatgctttttgaatgttatt	4920
tgttattttcagtattttggagaaattatttaataaaaaaacaatcatttgctttttgaa	4980
tgctctctaaaagggaatgtaatattttaagatggtgtgtaacccggctggataaatttt	5040
tggtgcctaagaaaactgcttgaatattcttatcaatgacagtgttaagtttcaaaaaga	5100
gcttctaaaacgtagattatcattcctttatagaatgttatgtggttaaaaccagaaagc	5160
acatctcacacattaatctgattttcatcccaacaatcttggcgctcaaaaaatagaact	5220
caatgagaaaaagaagattatgtgcacttcgttgtcaataataagtcaactgatgctcat	5280
cgacaactataggaggcttttcattaaatgggaaaagaagctgtgcccttttaggatacg	5340
tgggggaaaagaaagtcatcttaattatgtttaattgtggatttaagtgctatatggtgg	5400
tgctgtttgaaagcagatttatttcctatgtatgtgttatctggccatcccaacccaaac	5460
tgttgaagtttgtagtaacttcagtgagagttggttactcacaacaaatcctgaaaagta	5520
tttttagtgtttgtaggtattctgtgggatactatacaagcagaactgaggcacttagga	5580
cataacacttttggggtatatatatccaaatgcctaaaactatgggaggaaaccttggcc	5640
accccaaaaggaaaactaacatgatttgtgtctatgaagtgctggataattagcatggga	5700
tgagctctgggcatgccatgaaggaaagccacgctcccttcagaattcagaggcagggag	5760
caattccagtttcacctaagtctcataattttagttcccttttaaaaaccctgaaaacta	5820
catcaccatggaatgaaaaatattgttatacaatacattgatctgtcaaacttccagaac	5880
catggtagccttcagtgagatttccatcttggctggtcactccctgactgtagctgtagg	5940
tgaatgtgtttttgtgtgtgtgtgtctggttttagtgtcagaagggaaataaaagtgtaa	6000
ggaggacactttaaaccctttgggtggagtttcgtaatttcccagactattttcaagcaa	6060
cctggtccacccaggattagtgaccaggttttcaggaaaggatttgcttctctctagaaa	6120
atgtctgaaaggattttattttctgatgaaaggctgtatgaaaataccctcctcaaataa	6180
cttgcttaactacatatagattcaagtgtgtcaatattctattttgtatattaaatgcta	6240
tataatggggacaaatctatattatactgtgtatggcattattaagaagctttttcatta	6300
ttttttatcacagtaattttaaaatgtgtaaaaattaaaaccagtgactcctgtttaaaa	6360
ataaaagttgtagttttttattcatgctgaataataatctgtagttaaaaaaaaagtgtc	6420
tttttacctacgcagtgaaatgtcagactgtaaaaccttgtgtggaaatgtttaactttt	6480
attttttcatttaaatttgctgttctggtattaccaaaccacacatttgtaccgaattgg	6540
cagtaaatgttagccatttacagcaatgccaaatatggagaaacatcataataaaaaaat	6600
ctgctttttcatta                                              	6614
 
 
<210>	661
<211>	6517
<212>	DNA
<213>	Homo sapiens
 
<220>
<223>	cDNA sequence of human NR3C1 

<300>
<308>	NM_001018075.1
<309>	2009-04-12	
 
<400>	661
aggttatgtaagggtttgctttcaccccattcaaaaggtacctcttcctcttctcttgct	60
ccctctcgccctcattcttgtgcctatgcagacatttgagtagaggcgaatcactttcac	120
ttctgctggggaaattgcaacacgcttctttaaatggcagagagaaggagaaaacttaga	180
tcttctgataccaaatcactggaccttagaagttgatattcactgatggactccaaagaa	240
tcattaactcctggtagagaagaaaaccccagcagtgtgcttgctcaggagaggggagat	300
gtgatggacttctataaaaccctaagaggaggagctactgtgaaggtttctgcgtcttca	360
ccctcactggctgtcgcttctcaatcagactccaagcagcgaagacttttggttgatttt	420
ccaaaaggctcagtaagcaatgcgcagcagccagatctgtccaaagcagtttcactctca	480
atgggactgtatatgggagagacagaaacaaaagtgatgggaaatgacctgggattccca	540
cagcagggccaaatcagcctttcctcgggggaaacagacttaaagcttttggaagaaagc	600
attgcaaacctcaataggtcgaccagtgttccagagaaccccaagagttcagcatccact	660
gctgtgtctgctgcccccacagagaaggagtttccaaaaactcactctgatgtatcttca	720
gaacagcaacatttgaagggccagactggcaccaacggtggcaatgtgaaattgtatacc	780
acagaccaaagcacctttgacattttgcaggatttggagttttcttctgggtccccaggt	840
aaagagacgaatgagagtccttggagatcagacctgttgatagatgaaaactgtttgctt	900
tctcctctggcgggagaagacgattcattccttttggaaggaaactcgaatgaggactgc	960
aagcctctcattttaccggacactaaacccaaaattaaggataatggagatctggttttg	1020
tcaagccccagtaatgtaacactgccccaagtgaaaacagaaaaagaagatttcatcgaa	1080
ctctgcacccctggggtaattaagcaagagaaactgggcacagtttactgtcaggcaagc	1140
tttcctggagcaaatataattggtaataaaatgtctgccatttctgttcatggtgtgagt	1200
acctctggaggacagatgtaccactatgacatgaatacagcatccctttctcaacagcag	1260
gatcagaagcctatttttaatgtcattccaccaattcccgttggttccgaaaattggaat	1320
aggtgccaaggatctggagatgacaacttgacttctctggggactctgaacttccctggt	1380
cgaacagttttttctaatggctattcaagccccagcatgagaccagatgtaagctctcct	1440
ccatccagctcctcaacagcaacaacaggaccacctcccaaactctgcctggtgtgctct	1500
gatgaagcttcaggatgtcattatggagtcttaacttgtggaagctgtaaagttttcttc	1560
aaaagagcagtggaaggacagcacaattacctatgtgctggaaggaatgattgcatcatc	1620
gataaaattcgaagaaaaaactgcccagcatgccgctatcgaaaatgtcttcaggctgga	1680
atgaacctggaagctcgaaaaacaaagaaaaaaataaaaggaattcagcaggccactaca	1740
ggagtctcacaagaaacctctgaaaatcctggtaacaaaacaatagttcctgcaacgtta	1800
ccacaactcacccctaccctggtgtcactgttggaggttattgaacctgaagtgttatat	1860
gcaggatatgatagctctgttccagactcaacttggaggatcatgactacgctcaacatg	1920
ttaggagggcggcaagtgattgcagcagtgaaatgggcaaaggcaataccaggtttcagg	1980
aacttacacctggatgaccaaatgaccctactgcagtactcctggatgtttcttatggca	2040
tttgctctggggtggagatcatatagacaatcaagtgcaaacctgctgtgttttgctcct	2100
gatctgattattaatgagcagagaatgactctaccctgcatgtacgaccaatgtaaacac	2160
atgctgtatgtttcctctgagttacacaggcttcaggtatcttatgaagagtatctctgt	2220
atgaaaaccttactgcttctctcttcagttcctaaggacggtctgaagagccaagagcta	2280
tttgatgaaattagaatgacctacatcaaagagctaggaaaagccattgtcaagagggaa	2340
ggaaactccagccagaactggcagcggttttatcaactgacaaaactcttggattctatg	2400
catgaagtggttgaaaatctccttaactattgcttccaaacatttttggataagaccatg	2460
agtattgaattccccgagatgttagctgaaatcatcaccaatcagataccaaaatattca	2520
aatggaaatatcaaaaaacttctgtttcatcaaaagtgactgccttaataagaatggttg	2580
ccttaaagaaagtcgaattaatagcttttattgtataaactatcagtttgtcctgtagag	2640
gttttgttgttttattttttattgttttcatctgttgttttgttttaaatacgcactaca	2700
tgtggtttatagagggccaagacttggcaacagaagcagttgagtcgtcatcacttttca	2760
gtgatgggagagtagatggtgaaatttattagttaatatatcccagaaattagaaacctt	2820
aatatgtggacgtaatctccacagtcaaagaaggatggcacctaaaccaccagtgcccaa	2880
agtctgtgtgatgaactttctcttcatactttttttcacagttggctggatgaaattttc	2940
tagactttctgttggtgtatcccccccctgtatagttaggatagcatttttgatttatgc	3000
atggaaacctgaaaaaaagtttacaagtgtatatcagaaaagggaagttgtgccttttat	3060
agctattactgtctggttttaacaatttcctttatatttagtgaactacgcttgctcatt	3120
ttttcttacataattttttattcaagttattgtacagctgtttaagatgggcagctagtt	3180
cgtagctttcccaaataaactctaaacattaatcaatcatctgtgtgaaaatgggttggt	3240
gcttctaacctgatggcacttagctatcagaagaccacaaaaattgactcaaatctccag	3300
tattcttgtcaaaaaaaaaaaaaaaaaagctcatattttgtatatatctgcttcagtgga	3360
gaattatataggttgtgcaaattaacagtcctaactggtatagagcacctagtccagtga	3420
cctgctgggtaaactgtggatgatggttgcaaaagactaatttaaaaaataactaccaag	3480
aggccctgtctgtacctaacgccctatttttgcaatggctatatggcaagaaagctggta	3540
aactatttgtctttcaggaccttttgaagtagtttgtataacttcttaaaagttgtgatt	3600
ccagataaccagctgtaacacagctgagagacttttaatcagacaaagtaattcctctca	3660
ctaaactttacccaaaaactaaatctctaatatggcaaaaatggctagacacccattttc	3720
acattcccatctgtcaccaattggttaatctttcctgatggtacaggaaagctcagctac	3780
tgatttttgtgatttagaactgtatgtcagacatccatgtttgtaaaactacacatccct	3840
aatgtgtgccatagagtttaacacaagtcctgtgaatttcttcactgttgaaaattattt	3900
taaacaaaatagaagctgtagtagccctttctgtgtgcaccttaccaactttctgtaaac	3960
tcaaaacttaacatatttactaagccacaagaaatttgatttctattcaaggtggccaaa	4020
ttatttgtgtaatagaaaactgaaaatctaatattaaaaatatggaacttctaatatatt	4080
tttatatttagttatagtttcagatatatatcatattggtattcactaatctgggaaggg	4140
aagggctactgcagctttacatgcaatttattaaaatgattgtaaaatagcttgtatagt	4200
gtaaaataagaatgatttttagatgagattgttttatcatgacatgttatatattttttg	4260
taggggtcaaagaaatgctgatggataacctatatgatttatagtttgtacatgcattca	4320
tacaggcagcgatggtctcagaaaccaaacagtttgctctaggggaagagggagatggag	4380
actggtcctgtgtgcagtgaaggttgctgaggctctgacccagtgagattacagaggaag	4440
ttatcctctgcctcccattctgaccacccttctcattccaacagtgagtctgtcagcgca	4500
ggtttagtttactcaatctccccttgcactaaagtatgtaaagtatgtaaacaggagaca	4560
ggaaggtggtgcttacatccttaaaggcaccatctaatagcgggttactttcacatacag	4620
ccctcccccagcagttgaatgacaacagaagcttcagaagtttggcaatagtttgcatag	4680
aggtaccagcaatatgtaaatagtgcagaatctcataggttgccaataatacactaattc	4740
ctttctatcctacaacaagagtttatttccaaataaaatgaggacatgtttttgttttct	4800
ttgaatgctttttgaatgttatttgttattttcagtattttggagaaattatttaataaa	4860
aaaacaatcatttgctttttgaatgctctctaaaagggaatgtaatattttaagatggtg	4920
tgtaacccggctggataaatttttggtgcctaagaaaactgcttgaatattcttatcaat	4980
gacagtgttaagtttcaaaaagagcttctaaaacgtagattatcattcctttatagaatg	5040
ttatgtggttaaaaccagaaagcacatctcacacattaatctgattttcatcccaacaat	5100
cttggcgctcaaaaaatagaactcaatgagaaaaagaagattatgtgcacttcgttgtca	5160
ataataagtcaactgatgctcatcgacaactataggaggcttttcattaaatgggaaaag	5220
aagctgtgcccttttaggatacgtgggggaaaagaaagtcatcttaattatgtttaattg	5280
tggatttaagtgctatatggtggtgctgtttgaaagcagatttatttcctatgtatgtgt	5340
tatctggccatcccaacccaaactgttgaagtttgtagtaacttcagtgagagttggtta	5400
ctcacaacaaatcctgaaaagtatttttagtgtttgtaggtattctgtgggatactatac	5460
aagcagaactgaggcacttaggacataacacttttggggtatatatatccaaatgcctaa	5520
aactatgggaggaaaccttggccaccccaaaaggaaaactaacatgatttgtgtctatga	5580
agtgctggataattagcatgggatgagctctgggcatgccatgaaggaaagccacgctcc	5640
cttcagaattcagaggcagggagcaattccagtttcacctaagtctcataattttagttc	5700
ccttttaaaaaccctgaaaactacatcaccatggaatgaaaaatattgttatacaataca	5760
ttgatctgtcaaacttccagaaccatggtagccttcagtgagatttccatcttggctggt	5820
cactccctgactgtagctgtaggtgaatgtgtttttgtgtgtgtgtgtctggttttagtg	5880
tcagaagggaaataaaagtgtaaggaggacactttaaaccctttgggtggagtttcgtaa	5940
tttcccagactattttcaagcaacctggtccacccaggattagtgaccaggttttcagga	6000
aaggatttgcttctctctagaaaatgtctgaaaggattttattttctgatgaaaggctgt	6060
atgaaaataccctcctcaaataacttgcttaactacatatagattcaagtgtgtcaatat	6120
tctattttgtatattaaatgctatataatggggacaaatctatattatactgtgtatggc	6180
attattaagaagctttttcattattttttatcacagtaattttaaaatgtgtaaaaatta	6240
aaaccagtgactcctgtttaaaaataaaagttgtagttttttattcatgctgaataataa	6300
tctgtagttaaaaaaaaagtgtctttttacctacgcagtgaaatgtcagactgtaaaacc	6360
ttgtgtggaaatgtttaacttttattttttcatttaaatttgctgttctggtattaccaa	6420
accacacatttgtaccgaattggcagtaaatgttagccatttacagcaatgccaaatatg	6480
gagaaacatcataataaaaaaatctgctttttcatta                       	6517
 
 
<210>	662
<211>	6410
<212>	DNA
<213>	Homo sapiens
 
<220>
<223>	cDNA sequence of human NR3C1 

<300>
<308>	NM_001018076.1
<309>	2009-04-12	
 
<400>	662
cttctctcccagtgcgagagcgcggcggcggcagctgaagacccggccgcccagatgatg	60
cggtggtgggggacctgccggcacgcgactccccccgggcccaaattgatattcactgat	120
ggactccaaagaatcattaactcctggtagagaagaaaaccccagcagtgtgcttgctca	180
ggagaggggagatgtgatggacttctataaaaccctaagaggaggagctactgtgaaggt	240
ttctgcgtcttcaccctcactggctgtcgcttctcaatcagactccaagcagcgaagact	300
tttggttgattttccaaaaggctcagtaagcaatgcgcagcagccagatctgtccaaagc	360
agtttcactctcaatgggactgtatatgggagagacagaaacaaaagtgatgggaaatga	420
cctgggattcccacagcagggccaaatcagcctttcctcgggggaaacagacttaaagct	480
tttggaagaaagcattgcaaacctcaataggtcgaccagtgttccagagaaccccaagag	540
ttcagcatccactgctgtgtctgctgcccccacagagaaggagtttccaaaaactcactc	600
tgatgtatcttcagaacagcaacatttgaagggccagactggcaccaacggtggcaatgt	660
gaaattgtataccacagaccaaagcacctttgacattttgcaggatttggagttttcttc	720
tgggtccccaggtaaagagacgaatgagagtccttggagatcagacctgttgatagatga	780
aaactgtttgctttctcctctggcgggagaagacgattcattccttttggaaggaaactc	840
gaatgaggactgcaagcctctcattttaccggacactaaacccaaaattaaggataatgg	900
agatctggttttgtcaagccccagtaatgtaacactgccccaagtgaaaacagaaaaaga	960
agatttcatcgaactctgcacccctggggtaattaagcaagagaaactgggcacagttta	1020
ctgtcaggcaagctttcctggagcaaatataattggtaataaaatgtctgccatttctgt	1080
tcatggtgtgagtacctctggaggacagatgtaccactatgacatgaatacagcatccct	1140
ttctcaacagcaggatcagaagcctatttttaatgtcattccaccaattcccgttggttc	1200
cgaaaattggaataggtgccaaggatctggagatgacaacttgacttctctggggactct	1260
gaacttccctggtcgaacagttttttctaatggctattcaagccccagcatgagaccaga	1320
tgtaagctctcctccatccagctcctcaacagcaacaacaggaccacctcccaaactctg	1380
cctggtgtgctctgatgaagcttcaggatgtcattatggagtcttaacttgtggaagctg	1440
taaagttttcttcaaaagagcagtggaaggacagcacaattacctatgtgctggaaggaa	1500
tgattgcatcatcgataaaattcgaagaaaaaactgcccagcatgccgctatcgaaaatg	1560
tcttcaggctggaatgaacctggaagctcgaaaaacaaagaaaaaaataaaaggaattca	1620
gcaggccactacaggagtctcacaagaaacctctgaaaatcctggtaacaaaacaatagt	1680
tcctgcaacgttaccacaactcacccctaccctggtgtcactgttggaggttattgaacc	1740
tgaagtgttatatgcaggatatgatagctctgttccagactcaacttggaggatcatgac	1800
tacgctcaacatgttaggagggcggcaagtgattgcagcagtgaaatgggcaaaggcaat	1860
accaggtttcaggaacttacacctggatgaccaaatgaccctactgcagtactcctggat	1920
gtttcttatggcatttgctctggggtggagatcatatagacaatcaagtgcaaacctgct	1980
gtgttttgctcctgatctgattattaatgagcagagaatgactctaccctgcatgtacga	2040
ccaatgtaaacacatgctgtatgtttcctctgagttacacaggcttcaggtatcttatga	2100
agagtatctctgtatgaaaaccttactgcttctctcttcagttcctaaggacggtctgaa	2160
gagccaagagctatttgatgaaattagaatgacctacatcaaagagctaggaaaagccat	2220
tgtcaagagggaaggaaactccagccagaactggcagcggttttatcaactgacaaaact	2280
cttggattctatgcatgaagtggttgaaaatctccttaactattgcttccaaacattttt	2340
ggataagaccatgagtattgaattccccgagatgttagctgaaatcatcaccaatcagat	2400
accaaaatattcaaatggaaatatcaaaaaacttctgtttcatcaaaagtgactgcctta	2460
ataagaatggttgccttaaagaaagtcgaattaatagcttttattgtataaactatcagt	2520
ttgtcctgtagaggttttgttgttttattttttattgttttcatctgttgttttgtttta	2580
aatacgcactacatgtggtttatagagggccaagacttggcaacagaagcagttgagtcg	2640
tcatcacttttcagtgatgggagagtagatggtgaaatttattagttaatatatcccaga	2700
aattagaaaccttaatatgtggacgtaatctccacagtcaaagaaggatggcacctaaac	2760
caccagtgcccaaagtctgtgtgatgaactttctcttcatactttttttcacagttggct	2820
ggatgaaattttctagactttctgttggtgtatcccccccctgtatagttaggatagcat	2880
ttttgatttatgcatggaaacctgaaaaaaagtttacaagtgtatatcagaaaagggaag	2940
ttgtgccttttatagctattactgtctggttttaacaatttcctttatatttagtgaact	3000
acgcttgctcattttttcttacataattttttattcaagttattgtacagctgtttaaga	3060
tgggcagctagttcgtagctttcccaaataaactctaaacattaatcaatcatctgtgtg	3120
aaaatgggttggtgcttctaacctgatggcacttagctatcagaagaccacaaaaattga	3180
ctcaaatctccagtattcttgtcaaaaaaaaaaaaaaaaaagctcatattttgtatatat	3240
ctgcttcagtggagaattatataggttgtgcaaattaacagtcctaactggtatagagca	3300
cctagtccagtgacctgctgggtaaactgtggatgatggttgcaaaagactaatttaaaa	3360
aataactaccaagaggccctgtctgtacctaacgccctatttttgcaatggctatatggc	3420
aagaaagctggtaaactatttgtctttcaggaccttttgaagtagtttgtataacttctt	3480
aaaagttgtgattccagataaccagctgtaacacagctgagagacttttaatcagacaaa	3540
gtaattcctctcactaaactttacccaaaaactaaatctctaatatggcaaaaatggcta	3600
gacacccattttcacattcccatctgtcaccaattggttaatctttcctgatggtacagg	3660
aaagctcagctactgatttttgtgatttagaactgtatgtcagacatccatgtttgtaaa	3720
actacacatccctaatgtgtgccatagagtttaacacaagtcctgtgaatttcttcactg	3780
ttgaaaattattttaaacaaaatagaagctgtagtagccctttctgtgtgcaccttacca	3840
actttctgtaaactcaaaacttaacatatttactaagccacaagaaatttgatttctatt	3900
caaggtggccaaattatttgtgtaatagaaaactgaaaatctaatattaaaaatatggaa	3960
cttctaatatatttttatatttagttatagtttcagatatatatcatattggtattcact	4020
aatctgggaagggaagggctactgcagctttacatgcaatttattaaaatgattgtaaaa	4080
tagcttgtatagtgtaaaataagaatgatttttagatgagattgttttatcatgacatgt	4140
tatatattttttgtaggggtcaaagaaatgctgatggataacctatatgatttatagttt	4200
gtacatgcattcatacaggcagcgatggtctcagaaaccaaacagtttgctctaggggaa	4260
gagggagatggagactggtcctgtgtgcagtgaaggttgctgaggctctgacccagtgag	4320
attacagaggaagttatcctctgcctcccattctgaccacccttctcattccaacagtga	4380
gtctgtcagcgcaggtttagtttactcaatctccccttgcactaaagtatgtaaagtatg	4440
taaacaggagacaggaaggtggtgcttacatccttaaaggcaccatctaatagcgggtta	4500
ctttcacatacagccctcccccagcagttgaatgacaacagaagcttcagaagtttggca	4560
atagtttgcatagaggtaccagcaatatgtaaatagtgcagaatctcataggttgccaat	4620
aatacactaattcctttctatcctacaacaagagtttatttccaaataaaatgaggacat	4680
gtttttgttttctttgaatgctttttgaatgttatttgttattttcagtattttggagaa	4740
attatttaataaaaaaacaatcatttgctttttgaatgctctctaaaagggaatgtaata	4800
ttttaagatggtgtgtaacccggctggataaatttttggtgcctaagaaaactgcttgaa	4860
tattcttatcaatgacagtgttaagtttcaaaaagagcttctaaaacgtagattatcatt	4920
cctttatagaatgttatgtggttaaaaccagaaagcacatctcacacattaatctgattt	4980
tcatcccaacaatcttggcgctcaaaaaatagaactcaatgagaaaaagaagattatgtg	5040
cacttcgttgtcaataataagtcaactgatgctcatcgacaactataggaggcttttcat	5100
taaatgggaaaagaagctgtgcccttttaggatacgtgggggaaaagaaagtcatcttaa	5160
ttatgtttaattgtggatttaagtgctatatggtggtgctgtttgaaagcagatttattt	5220
cctatgtatgtgttatctggccatcccaacccaaactgttgaagtttgtagtaacttcag	5280
tgagagttggttactcacaacaaatcctgaaaagtatttttagtgtttgtaggtattctg	5340
tgggatactatacaagcagaactgaggcacttaggacataacacttttggggtatatata	5400
tccaaatgcctaaaactatgggaggaaaccttggccaccccaaaaggaaaactaacatga	5460
tttgtgtctatgaagtgctggataattagcatgggatgagctctgggcatgccatgaagg	5520
aaagccacgctcccttcagaattcagaggcagggagcaattccagtttcacctaagtctc	5580
ataattttagttcccttttaaaaaccctgaaaactacatcaccatggaatgaaaaatatt	5640
gttatacaatacattgatctgtcaaacttccagaaccatggtagccttcagtgagatttc	5700
catcttggctggtcactccctgactgtagctgtaggtgaatgtgtttttgtgtgtgtgtg	5760
tctggttttagtgtcagaagggaaataaaagtgtaaggaggacactttaaaccctttggg	5820
tggagtttcgtaatttcccagactattttcaagcaacctggtccacccaggattagtgac	5880
caggttttcaggaaaggatttgcttctctctagaaaatgtctgaaaggattttattttct	5940
gatgaaaggctgtatgaaaataccctcctcaaataacttgcttaactacatatagattca	6000
agtgtgtcaatattctattttgtatattaaatgctatataatggggacaaatctatatta	6060
tactgtgtatggcattattaagaagctttttcattattttttatcacagtaattttaaaa	6120
tgtgtaaaaattaaaaccagtgactcctgtttaaaaataaaagttgtagttttttattca	6180
tgctgaataataatctgtagttaaaaaaaaagtgtctttttacctacgcagtgaaatgtc	6240
agactgtaaaaccttgtgtggaaatgtttaacttttattttttcatttaaatttgctgtt	6300
ctggtattaccaaaccacacatttgtaccgaattggcagtaaatgttagccatttacagc	6360
aatgccaaatatggagaaacatcataataaaaaaatctgctttttcatta            	6410
 
 
<210>	663
<211>	7286
<212>	DNA
<213>	Homo sapiens
 
<220>
<223>	cDNA sequence of human NR3C1 

<300>
<308>	NM_001018077.1
<309>	2009-04-12	
 
<400>	663
aggttatgtaagggtttgctttcaccccattcaaaaggtacctcttcctcttctcttgct	60
ccctctcgccctcattcttgtgcctatgcagacatttgagtagaggcgaatcactttcac	120
ttctgctggggaaattgcaacacgcttctttaaatggcagagagaaggagaaaacttaga	180
tcttctgataccaaatcactggaccttagaaggtcagaaatctttcaagccctgcaggac	240
cgtaaaatgcgcatgtgtccaacggaagcactggggcatgagtggggaaggaatagaaac	300
agaaagagggtaagagaagaaaaaagggaaagtggtgaaggcagggaggaaaattgctta	360
gtgtgaatatgcacgcattcatttagttttcaaatccttgttgagcatgataaaattccc	420
agcatcagacctcacatgttggtttccattaggatctgcctgggggaatatctgctgaat	480
cagtggctctgagctgaactaggaaattcaccataattaggagagtcactgtatttctct	540
ccaaaaaaaaaaaagttatacccgagagacaggatcttctgatctgaaattttcttcact	600
tctgaaattctctggtttgtgctcatcgttggtagctatttgttcatcaagagttgtgta	660
gctggcttcttctgaaaaaaggaatctgcgtcatatctaagtcagatttcattctggtgc	720
tctcagagcagttagcccaggaaaggggccagcttctgtgacgactgctgcagaggcagg	780
tgcagtttgtgtgccacagatattaactttgataagcacttaatgagtgccttctctgtg	840
cgagaatggggaggaacaaaatgcagctcctaccctcctcgggctttagttgtaccttaa	900
taacaggaattttcatctgcctggctcctttcctcaaagaacaaagaagactttgcttca	960
ttaaagtgtctgagaaggaagttgatattcactgatggactccaaagaatcattaactcc	1020
tggtagagaagaaaaccccagcagtgtgcttgctcaggagaggggagatgtgatggactt	1080
ctataaaaccctaagaggaggagctactgtgaaggtttctgcgtcttcaccctcactggc	1140
tgtcgcttctcaatcagactccaagcagcgaagacttttggttgattttccaaaaggctc	1200
agtaagcaatgcgcagcagccagatctgtccaaagcagtttcactctcaatgggactgta	1260
tatgggagagacagaaacaaaagtgatgggaaatgacctgggattcccacagcagggcca	1320
aatcagcctttcctcgggggaaacagacttaaagcttttggaagaaagcattgcaaacct	1380
caataggtcgaccagtgttccagagaaccccaagagttcagcatccactgctgtgtctgc	1440
tgcccccacagagaaggagtttccaaaaactcactctgatgtatcttcagaacagcaaca	1500
tttgaagggccagactggcaccaacggtggcaatgtgaaattgtataccacagaccaaag	1560
cacctttgacattttgcaggatttggagttttcttctgggtccccaggtaaagagacgaa	1620
tgagagtccttggagatcagacctgttgatagatgaaaactgtttgctttctcctctggc	1680
gggagaagacgattcattccttttggaaggaaactcgaatgaggactgcaagcctctcat	1740
tttaccggacactaaacccaaaattaaggataatggagatctggttttgtcaagccccag	1800
taatgtaacactgccccaagtgaaaacagaaaaagaagatttcatcgaactctgcacccc	1860
tggggtaattaagcaagagaaactgggcacagtttactgtcaggcaagctttcctggagc	1920
aaatataattggtaataaaatgtctgccatttctgttcatggtgtgagtacctctggagg	1980
acagatgtaccactatgacatgaatacagcatccctttctcaacagcaggatcagaagcc	2040
tatttttaatgtcattccaccaattcccgttggttccgaaaattggaataggtgccaagg	2100
atctggagatgacaacttgacttctctggggactctgaacttccctggtcgaacagtttt	2160
ttctaatggctattcaagccccagcatgagaccagatgtaagctctcctccatccagctc	2220
ctcaacagcaacaacaggaccacctcccaaactctgcctggtgtgctctgatgaagcttc	2280
aggatgtcattatggagtcttaacttgtggaagctgtaaagttttcttcaaaagagcagt	2340
ggaaggacagcacaattacctatgtgctggaaggaatgattgcatcatcgataaaattcg	2400
aagaaaaaactgcccagcatgccgctatcgaaaatgtcttcaggctggaatgaacctgga	2460
agctcgaaaaacaaagaaaaaaataaaaggaattcagcaggccactacaggagtctcaca	2520
agaaacctctgaaaatcctggtaacaaaacaatagttcctgcaacgttaccacaactcac	2580
ccctaccctggtgtcactgttggaggttattgaacctgaagtgttatatgcaggatatga	2640
tagctctgttccagactcaacttggaggatcatgactacgctcaacatgttaggagggcg	2700
gcaagtgattgcagcagtgaaatgggcaaaggcaataccaggtttcaggaacttacacct	2760
ggatgaccaaatgaccctactgcagtactcctggatgtttcttatggcatttgctctggg	2820
gtggagatcatatagacaatcaagtgcaaacctgctgtgttttgctcctgatctgattat	2880
taatgagcagagaatgactctaccctgcatgtacgaccaatgtaaacacatgctgtatgt	2940
ttcctctgagttacacaggcttcaggtatcttatgaagagtatctctgtatgaaaacctt	3000
actgcttctctcttcagttcctaaggacggtctgaagagccaagagctatttgatgaaat	3060
tagaatgacctacatcaaagagctaggaaaagccattgtcaagagggaaggaaactccag	3120
ccagaactggcagcggttttatcaactgacaaaactcttggattctatgcatgaagtggt	3180
tgaaaatctccttaactattgcttccaaacatttttggataagaccatgagtattgaatt	3240
ccccgagatgttagctgaaatcatcaccaatcagataccaaaatattcaaatggaaatat	3300
caaaaaacttctgtttcatcaaaagtgactgccttaataagaatggttgccttaaagaaa	3360
gtcgaattaatagcttttattgtataaactatcagtttgtcctgtagaggttttgttgtt	3420
ttattttttattgttttcatctgttgttttgttttaaatacgcactacatgtggtttata	3480
gagggccaagacttggcaacagaagcagttgagtcgtcatcacttttcagtgatgggaga	3540
gtagatggtgaaatttattagttaatatatcccagaaattagaaaccttaatatgtggac	3600
gtaatctccacagtcaaagaaggatggcacctaaaccaccagtgcccaaagtctgtgtga	3660
tgaactttctcttcatactttttttcacagttggctggatgaaattttctagactttctg	3720
ttggtgtatcccccccctgtatagttaggatagcatttttgatttatgcatggaaacctg	3780
aaaaaaagtttacaagtgtatatcagaaaagggaagttgtgccttttatagctattactg	3840
tctggttttaacaatttcctttatatttagtgaactacgcttgctcattttttcttacat	3900
aattttttattcaagttattgtacagctgtttaagatgggcagctagttcgtagctttcc	3960
caaataaactctaaacattaatcaatcatctgtgtgaaaatgggttggtgcttctaacct	4020
gatggcacttagctatcagaagaccacaaaaattgactcaaatctccagtattcttgtca	4080
aaaaaaaaaaaaaaaaagctcatattttgtatatatctgcttcagtggagaattatatag	4140
gttgtgcaaattaacagtcctaactggtatagagcacctagtccagtgacctgctgggta	4200
aactgtggatgatggttgcaaaagactaatttaaaaaataactaccaagaggccctgtct	4260
gtacctaacgccctatttttgcaatggctatatggcaagaaagctggtaaactatttgtc	4320
tttcaggaccttttgaagtagtttgtataacttcttaaaagttgtgattccagataacca	4380
gctgtaacacagctgagagacttttaatcagacaaagtaattcctctcactaaactttac	4440
ccaaaaactaaatctctaatatggcaaaaatggctagacacccattttcacattcccatc	4500
tgtcaccaattggttaatctttcctgatggtacaggaaagctcagctactgatttttgtg	4560
atttagaactgtatgtcagacatccatgtttgtaaaactacacatccctaatgtgtgcca	4620
tagagtttaacacaagtcctgtgaatttcttcactgttgaaaattattttaaacaaaata	4680
gaagctgtagtagccctttctgtgtgcaccttaccaactttctgtaaactcaaaacttaa	4740
catatttactaagccacaagaaatttgatttctattcaaggtggccaaattatttgtgta	4800
atagaaaactgaaaatctaatattaaaaatatggaacttctaatatatttttatatttag	4860
ttatagtttcagatatatatcatattggtattcactaatctgggaagggaagggctactg	4920
cagctttacatgcaatttattaaaatgattgtaaaatagcttgtatagtgtaaaataaga	4980
atgatttttagatgagattgttttatcatgacatgttatatattttttgtaggggtcaaa	5040
gaaatgctgatggataacctatatgatttatagtttgtacatgcattcatacaggcagcg	5100
atggtctcagaaaccaaacagtttgctctaggggaagagggagatggagactggtcctgt	5160
gtgcagtgaaggttgctgaggctctgacccagtgagattacagaggaagttatcctctgc	5220
ctcccattctgaccacccttctcattccaacagtgagtctgtcagcgcaggtttagttta	5280
ctcaatctccccttgcactaaagtatgtaaagtatgtaaacaggagacaggaaggtggtg	5340
cttacatccttaaaggcaccatctaatagcgggttactttcacatacagccctcccccag	5400
cagttgaatgacaacagaagcttcagaagtttggcaatagtttgcatagaggtaccagca	5460
atatgtaaatagtgcagaatctcataggttgccaataatacactaattcctttctatcct	5520
acaacaagagtttatttccaaataaaatgaggacatgtttttgttttctttgaatgcttt	5580
ttgaatgttatttgttattttcagtattttggagaaattatttaataaaaaaacaatcat	5640
ttgctttttgaatgctctctaaaagggaatgtaatattttaagatggtgtgtaacccggc	5700
tggataaatttttggtgcctaagaaaactgcttgaatattcttatcaatgacagtgttaa	5760
gtttcaaaaagagcttctaaaacgtagattatcattcctttatagaatgttatgtggtta	5820
aaaccagaaagcacatctcacacattaatctgattttcatcccaacaatcttggcgctca	5880
aaaaatagaactcaatgagaaaaagaagattatgtgcacttcgttgtcaataataagtca	5940
actgatgctcatcgacaactataggaggcttttcattaaatgggaaaagaagctgtgccc	6000
ttttaggatacgtgggggaaaagaaagtcatcttaattatgtttaattgtggatttaagt	6060
gctatatggtggtgctgtttgaaagcagatttatttcctatgtatgtgttatctggccat	6120
cccaacccaaactgttgaagtttgtagtaacttcagtgagagttggttactcacaacaaa	6180
tcctgaaaagtatttttagtgtttgtaggtattctgtgggatactatacaagcagaactg	6240
aggcacttaggacataacacttttggggtatatatatccaaatgcctaaaactatgggag	6300
gaaaccttggccaccccaaaaggaaaactaacatgatttgtgtctatgaagtgctggata	6360
attagcatgggatgagctctgggcatgccatgaaggaaagccacgctcccttcagaattc	6420
agaggcagggagcaattccagtttcacctaagtctcataattttagttcccttttaaaaa	6480
ccctgaaaactacatcaccatggaatgaaaaatattgttatacaatacattgatctgtca	6540
aacttccagaaccatggtagccttcagtgagatttccatcttggctggtcactccctgac	6600
tgtagctgtaggtgaatgtgtttttgtgtgtgtgtgtctggttttagtgtcagaagggaa	6660
ataaaagtgtaaggaggacactttaaaccctttgggtggagtttcgtaatttcccagact	6720
attttcaagcaacctggtccacccaggattagtgaccaggttttcaggaaaggatttgct	6780
tctctctagaaaatgtctgaaaggattttattttctgatgaaaggctgtatgaaaatacc	6840
ctcctcaaataacttgcttaactacatatagattcaagtgtgtcaatattctattttgta	6900
tattaaatgctatataatggggacaaatctatattatactgtgtatggcattattaagaa	6960
gctttttcattattttttatcacagtaattttaaaatgtgtaaaaattaaaaccagtgac	7020
tcctgtttaaaaataaaagttgtagttttttattcatgctgaataataatctgtagttaa	7080
aaaaaaagtgtctttttacctacgcagtgaaatgtcagactgtaaaaccttgtgtggaaa	7140
tgtttaacttttattttttcatttaaatttgctgttctggtattaccaaaccacacattt	7200
gtaccgaattggcagtaaatgttagccatttacagcaatgccaaatatggagaaacatca	7260
taataaaaaaatctgctttttcatta                                  	7286
 
 
<210>	664
<211>	4154
<212>	DNA
<213>	Homo sapiens
 
<220>
<223>	cDNA sequence of human NR3C1 

<300>
<308>	NM_001020825.1
<309>	2009-04-12	
 
<400>	664
ggcgccgcctccacccgctccccgctcggtcccgctcgctcgcccaggccgggctgccct	60
ttcgcgtgtccgcgctctcttccctccgccgccgcctcctccattttgcgagctcgtgtc	120
tgtgacgggagcccgagtcaccgcctgcccgtcggggacggattctgtgggtggaaggag	180
acgccgcagccggagcggccgaagcagctgggaccgggacggggcacgcgcgcccggaac	240
ctcgacccgcggagcccggcgcggggcggagggctggcttgtcagctgggcaatgggaga	300
ctttcttaaataggggctctccccccacccatggagaaaggggcggctgtttacttcctt	360
tttttagaaaaaaaaaatatatttccctcctgctccttctgcgttcacaagctaagttgt	420
ttatctcggctgcggcgggaactgcggacggtggcgggcgagcggctcctctgccagagt	480
tgatattcactgatggactccaaagaatcattaactcctggtagagaagaaaaccccagc	540
agtgtgcttgctcaggagaggggagatgtgatggacttctataaaaccctaagaggagga	600
gctactgtgaaggtttctgcgtcttcaccctcactggctgtcgcttctcaatcagactcc	660
aagcagcgaagacttttggttgattttccaaaaggctcagtaagcaatgcgcagcagcca	720
gatctgtccaaagcagtttcactctcaatgggactgtatatgggagagacagaaacaaaa	780
gtgatgggaaatgacctgggattcccacagcagggccaaatcagcctttcctcgggggaa	840
acagacttaaagcttttggaagaaagcattgcaaacctcaataggtcgaccagtgttcca	900
gagaaccccaagagttcagcatccactgctgtgtctgctgcccccacagagaaggagttt	960
ccaaaaactcactctgatgtatcttcagaacagcaacatttgaagggccagactggcacc	1020
aacggtggcaatgtgaaattgtataccacagaccaaagcacctttgacattttgcaggat	1080
ttggagttttcttctgggtccccaggtaaagagacgaatgagagtccttggagatcagac	1140
ctgttgatagatgaaaactgtttgctttctcctctggcgggagaagacgattcattcctt	1200
ttggaaggaaactcgaatgaggactgcaagcctctcattttaccggacactaaacccaaa	1260
attaaggataatggagatctggttttgtcaagccccagtaatgtaacactgccccaagtg	1320
aaaacagaaaaagaagatttcatcgaactctgcacccctggggtaattaagcaagagaaa	1380
ctgggcacagtttactgtcaggcaagctttcctggagcaaatataattggtaataaaatg	1440
tctgccatttctgttcatggtgtgagtacctctggaggacagatgtaccactatgacatg	1500
aatacagcatccctttctcaacagcaggatcagaagcctatttttaatgtcattccacca	1560
attcccgttggttccgaaaattggaataggtgccaaggatctggagatgacaacttgact	1620
tctctggggactctgaacttccctggtcgaacagttttttctaatggctattcaagcccc	1680
agcatgagaccagatgtaagctctcctccatccagctcctcaacagcaacaacaggacca	1740
cctcccaaactctgcctggtgtgctctgatgaagcttcaggatgtcattatggagtctta	1800
acttgtggaagctgtaaagttttcttcaaaagagcagtggaaggacagcacaattaccta	1860
tgtgctggaaggaatgattgcatcatcgataaaattcgaagaaaaaactgcccagcatgc	1920
cgctatcgaaaatgtcttcaggctggaatgaacctggaagctcgaaaaacaaagaaaaaa	1980
ataaaaggaattcagcaggccactacaggagtctcacaagaaacctctgaaaatcctggt	2040
aacaaaacaatagttcctgcaacgttaccacaactcacccctaccctggtgtcactgttg	2100
gaggttattgaacctgaagtgttatatgcaggatatgatagctctgttccagactcaact	2160
tggaggatcatgactacgctcaacatgttaggagggcggcaagtgattgcagcagtgaaa	2220
tgggcaaaggcaataccaggtttcaggaacttacacctggatgaccaaatgaccctactg	2280
cagtactcctggatgtttcttatggcatttgctctggggtggagatcatatagacaatca	2340
agtgcaaacctgctgtgttttgctcctgatctgattattaatgagcagagaatgactcta	2400
ccctgcatgtacgaccaatgtaaacacatgctgtatgtttcctctgagttacacaggctt	2460
caggtatcttatgaagagtatctctgtatgaaaaccttactgcttctctcttcagttcct	2520
aaggacggtctgaagagccaagagctatttgatgaaattagaatgacctacatcaaagag	2580
ctaggaaaagccattgtcaagagggaaggaaactccagccagaactggcagcggttttat	2640
caactgacaaaactcttggattctatgcatgaaaatgttatgtggttaaaaccagaaagc	2700
acatctcacacattaatctgattttcatcccaacaatcttggcgctcaaaaaatagaact	2760
caatgagaaaaagaagattatgtgcacttcgttgtcaataataagtcaactgatgctcat	2820
cgacaactataggaggcttttcattaaatgggaaaagaagctgtgcccttttaggatacg	2880
tgggggaaaagaaagtcatcttaattatgtttaattgtggatttaagtgctatatggtgg	2940
tgctgtttgaaagcagatttatttcctatgtatgtgttatctggccatcccaacccaaac	3000
tgttgaagtttgtagtaacttcagtgagagttggttactcacaacaaatcctgaaaagta	3060
tttttagtgtttgtaggtattctgtgggatactatacaagcagaactgaggcacttagga	3120
cataacacttttggggtatatatatccaaatgcctaaaactatgggaggaaaccttggcc	3180
accccaaaaggaaaactaacatgatttgtgtctatgaagtgctggataattagcatggga	3240
tgagctctgggcatgccatgaaggaaagccacgctcccttcagaattcagaggcagggag	3300
caattccagtttcacctaagtctcataattttagttcccttttaaaaaccctgaaaacta	3360
catcaccatggaatgaaaaatattgttatacaatacattgatctgtcaaacttccagaac	3420
catggtagccttcagtgagatttccatcttggctggtcactccctgactgtagctgtagg	3480
tgaatgtgtttttgtgtgtgtgtgtctggttttagtgtcagaagggaaataaaagtgtaa	3540
ggaggacactttaaaccctttgggtggagtttcgtaatttcccagactattttcaagcaa	3600
cctggtccacccaggattagtgaccaggttttcaggaaaggatttgcttctctctagaaa	3660
atgtctgaaaggattttattttctgatgaaaggctgtatgaaaataccctcctcaaataa	3720
cttgcttaactacatatagattcaagtgtgtcaatattctattttgtatattaaatgcta	3780
tataatggggacaaatctatattatactgtgtatggcattattaagaagctttttcatta	3840
ttttttatcacagtaattttaaaatgtgtaaaaattaaaaccagtgactcctgtttaaaa	3900
ataaaagttgtagttttttattcatgctgaataataatctgtagttaaaaaaaaagtgtc	3960
tttttacctacgcagtgaaatgtcagactgtaaaaccttgtgtggaaatgtttaactttt	4020
attttttcatttaaatttgctgttctggtattaccaaaccacacatttgtaccgaattgg	4080
cagtaaatgttagccatttacagcaatgccaaatatggagaaacatcataataaaaaaat	4140
ctgctttttcatta                                              	4154
 
 
<210>	665
<211>	6787
<212>	DNA
<213>	Homo sapiens
 
<220>
<223>	cDNA sequence of human NR3C1 

<300>
<308>	NM_001024094.1
<309>	2009-04-12	
 
<400>	665
ggcgccgcctccacccgctccccgctcggtcccgctcgctcgcccaggccgggctgccct	60
ttcgcgtgtccgcgctctcttccctccgccgccgcctcctccattttgcgagctcgtgtc	120
tgtgacgggagcccgagtcaccgcctgcccgtcggggacggattctgtgggtggaaggag	180
acgccgcagccggagcggccgaagcagctgggaccgggacggggcacgcgcgcccggaac	240
ctcgacccgcggagcccggcgcggggcggagggctggcttgtcagctgggcaatgggaga	300
ctttcttaaataggggctctccccccacccatggagaaaggggcggctgtttacttcctt	360
tttttagaaaaaaaaaatatatttccctcctgctccttctgcgttcacaagctaagttgt	420
ttatctcggctgcggcgggaactgcggacggtggcgggcgagcggctcctctgccagagt	480
tgatattcactgatggactccaaagaatcattaactcctggtagagaagaaaaccccagc	540
agtgtgcttgctcaggagaggggagatgtgatggacttctataaaaccctaagaggagga	600
gctactgtgaaggtttctgcgtcttcaccctcactggctgtcgcttctcaatcagactcc	660
aagcagcgaagacttttggttgattttccaaaaggctcagtaagcaatgcgcagcagcca	720
gatctgtccaaagcagtttcactctcaatgggactgtatatgggagagacagaaacaaaa	780
gtgatgggaaatgacctgggattcccacagcagggccaaatcagcctttcctcgggggaa	840
acagacttaaagcttttggaagaaagcattgcaaacctcaataggtcgaccagtgttcca	900
gagaaccccaagagttcagcatccactgctgtgtctgctgcccccacagagaaggagttt	960
ccaaaaactcactctgatgtatcttcagaacagcaacatttgaagggccagactggcacc	1020
aacggtggcaatgtgaaattgtataccacagaccaaagcacctttgacattttgcaggat	1080
ttggagttttcttctgggtccccaggtaaagagacgaatgagagtccttggagatcagac	1140
ctgttgatagatgaaaactgtttgctttctcctctggcgggagaagacgattcattcctt	1200
ttggaaggaaactcgaatgaggactgcaagcctctcattttaccggacactaaacccaaa	1260
attaaggataatggagatctggttttgtcaagccccagtaatgtaacactgccccaagtg	1320
aaaacagaaaaagaagatttcatcgaactctgcacccctggggtaattaagcaagagaaa	1380
ctgggcacagtttactgtcaggcaagctttcctggagcaaatataattggtaataaaatg	1440
tctgccatttctgttcatggtgtgagtacctctggaggacagatgtaccactatgacatg	1500
aatacagcatccctttctcaacagcaggatcagaagcctatttttaatgtcattccacca	1560
attcccgttggttccgaaaattggaataggtgccaaggatctggagatgacaacttgact	1620
tctctggggactctgaacttccctggtcgaacagttttttctaatggctattcaagcccc	1680
agcatgagaccagatgtaagctctcctccatccagctcctcaacagcaacaacaggacca	1740
cctcccaaactctgcctggtgtgctctgatgaagcttcaggatgtcattatggagtctta	1800
acttgtggaagctgtaaagttttcttcaaaagagcagtggaaggtagacagcacaattac	1860
ctatgtgctggaaggaatgattgcatcatcgataaaattcgaagaaaaaactgcccagca	1920
tgccgctatcgaaaatgtcttcaggctggaatgaacctggaagctcgaaaaacaaagaaa	1980
aaaataaaaggaattcagcaggccactacaggagtctcacaagaaacctctgaaaatcct	2040
ggtaacaaaacaatagttcctgcaacgttaccacaactcacccctaccctggtgtcactg	2100
ttggaggttattgaacctgaagtgttatatgcaggatatgatagctctgttccagactca	2160
acttggaggatcatgactacgctcaacatgttaggagggcggcaagtgattgcagcagtg	2220
aaatgggcaaaggcaataccaggtttcaggaacttacacctggatgaccaaatgacccta	2280
ctgcagtactcctggatgtttcttatggcatttgctctggggtggagatcatatagacaa	2340
tcaagtgcaaacctgctgtgttttgctcctgatctgattattaatgagcagagaatgact	2400
ctaccctgcatgtacgaccaatgtaaacacatgctgtatgtttcctctgagttacacagg	2460
cttcaggtatcttatgaagagtatctctgtatgaaaaccttactgcttctctcttcagtt	2520
cctaaggacggtctgaagagccaagagctatttgatgaaattagaatgacctacatcaaa	2580
gagctaggaaaagccattgtcaagagggaaggaaactccagccagaactggcagcggttt	2640
tatcaactgacaaaactcttggattctatgcatgaagtggttgaaaatctccttaactat	2700
tgcttccaaacatttttggataagaccatgagtattgaattccccgagatgttagctgaa	2760
atcatcaccaatcagataccaaaatattcaaatggaaatatcaaaaaacttctgtttcat	2820
caaaagtgactgccttaataagaatggttgccttaaagaaagtcgaattaatagctttta	2880
ttgtataaactatcagtttgtcctgtagaggttttgttgttttattttttattgttttca	2940
tctgttgttttgttttaaatacgcactacatgtggtttatagagggccaagacttggcaa	3000
cagaagcagttgagtcgtcatcacttttcagtgatgggagagtagatggtgaaatttatt	3060
agttaatatatcccagaaattagaaaccttaatatgtggacgtaatctccacagtcaaag	3120
aaggatggcacctaaaccaccagtgcccaaagtctgtgtgatgaactttctcttcatact	3180
ttttttcacagttggctggatgaaattttctagactttctgttggtgtatcccccccctg	3240
tatagttaggatagcatttttgatttatgcatggaaacctgaaaaaaagtttacaagtgt	3300
atatcagaaaagggaagttgtgccttttatagctattactgtctggttttaacaatttcc	3360
tttatatttagtgaactacgcttgctcattttttcttacataattttttattcaagttat	3420
tgtacagctgtttaagatgggcagctagttcgtagctttcccaaataaactctaaacatt	3480
aatcaatcatctgtgtgaaaatgggttggtgcttctaacctgatggcacttagctatcag	3540
aagaccacaaaaattgactcaaatctccagtattcttgtcaaaaaaaaaaaaaaaaaagc	3600
tcatattttgtatatatctgcttcagtggagaattatataggttgtgcaaattaacagtc	3660
ctaactggtatagagcacctagtccagtgacctgctgggtaaactgtggatgatggttgc	3720
aaaagactaatttaaaaaataactaccaagaggccctgtctgtacctaacgccctatttt	3780
tgcaatggctatatggcaagaaagctggtaaactatttgtctttcaggaccttttgaagt	3840
agtttgtataacttcttaaaagttgtgattccagataaccagctgtaacacagctgagag	3900
acttttaatcagacaaagtaattcctctcactaaactttacccaaaaactaaatctctaa	3960
tatggcaaaaatggctagacacccattttcacattcccatctgtcaccaattggttaatc	4020
tttcctgatggtacaggaaagctcagctactgatttttgtgatttagaactgtatgtcag	4080
acatccatgtttgtaaaactacacatccctaatgtgtgccatagagtttaacacaagtcc	4140
tgtgaatttcttcactgttgaaaattattttaaacaaaatagaagctgtagtagcccttt	4200
ctgtgtgcaccttaccaactttctgtaaactcaaaacttaacatatttactaagccacaa	4260
gaaatttgatttctattcaaggtggccaaattatttgtgtaatagaaaactgaaaatcta	4320
atattaaaaatatggaacttctaatatatttttatatttagttatagtttcagatatata	4380
tcatattggtattcactaatctgggaagggaagggctactgcagctttacatgcaattta	4440
ttaaaatgattgtaaaatagcttgtatagtgtaaaataagaatgatttttagatgagatt	4500
gttttatcatgacatgttatatattttttgtaggggtcaaagaaatgctgatggataacc	4560
tatatgatttatagtttgtacatgcattcatacaggcagcgatggtctcagaaaccaaac	4620
agtttgctctaggggaagagggagatggagactggtcctgtgtgcagtgaaggttgctga	4680
ggctctgacccagtgagattacagaggaagttatcctctgcctcccattctgaccaccct	4740
tctcattccaacagtgagtctgtcagcgcaggtttagtttactcaatctccccttgcact	4800
aaagtatgtaaagtatgtaaacaggagacaggaaggtggtgcttacatccttaaaggcac	4860
catctaatagcgggttactttcacatacagccctcccccagcagttgaatgacaacagaa	4920
gcttcagaagtttggcaatagtttgcatagaggtaccagcaatatgtaaatagtgcagaa	4980
tctcataggttgccaataatacactaattcctttctatcctacaacaagagtttatttcc	5040
aaataaaatgaggacatgtttttgttttctttgaatgctttttgaatgttatttgttatt	5100
ttcagtattttggagaaattatttaataaaaaaacaatcatttgctttttgaatgctctc	5160
taaaagggaatgtaatattttaagatggtgtgtaacccggctggataaatttttggtgcc	5220
taagaaaactgcttgaatattcttatcaatgacagtgttaagtttcaaaaagagcttcta	5280
aaacgtagattatcattcctttatagaatgttatgtggttaaaaccagaaagcacatctc	5340
acacattaatctgattttcatcccaacaatcttggcgctcaaaaaatagaactcaatgag	5400
aaaaagaagattatgtgcacttcgttgtcaataataagtcaactgatgctcatcgacaac	5460
tataggaggcttttcattaaatgggaaaagaagctgtgcccttttaggatacgtggggga	5520
aaagaaagtcatcttaattatgtttaattgtggatttaagtgctatatggtggtgctgtt	5580
tgaaagcagatttatttcctatgtatgtgttatctggccatcccaacccaaactgttgaa	5640
gtttgtagtaacttcagtgagagttggttactcacaacaaatcctgaaaagtatttttag	5700
tgtttgtaggtattctgtgggatactatacaagcagaactgaggcacttaggacataaca	5760
cttttggggtatatatatccaaatgcctaaaactatgggaggaaaccttggccaccccaa	5820
aaggaaaactaacatgatttgtgtctatgaagtgctggataattagcatgggatgagctc	5880
tgggcatgccatgaaggaaagccacgctcccttcagaattcagaggcagggagcaattcc	5940
agtttcacctaagtctcataattttagttcccttttaaaaaccctgaaaactacatcacc	6000
atggaatgaaaaatattgttatacaatacattgatctgtcaaacttccagaaccatggta	6060
gccttcagtgagatttccatcttggctggtcactccctgactgtagctgtaggtgaatgt	6120
gtttttgtgtgtgtgtgtctggttttagtgtcagaagggaaataaaagtgtaaggaggac	6180
actttaaaccctttgggtggagtttcgtaatttcccagactattttcaagcaacctggtc	6240
cacccaggattagtgaccaggttttcaggaaaggatttgcttctctctagaaaatgtctg	6300
aaaggattttattttctgatgaaaggctgtatgaaaataccctcctcaaataacttgctt	6360
aactacatatagattcaagtgtgtcaatattctattttgtatattaaatgctatataatg	6420
gggacaaatctatattatactgtgtatggcattattaagaagctttttcattatttttta	6480
tcacagtaattttaaaatgtgtaaaaattaaaaccagtgactcctgtttaaaaataaaag	6540
ttgtagttttttattcatgctgaataataatctgtagttaaaaaaaaagtgtctttttac	6600
ctacgcagtgaaatgtcagactgtaaaaccttgtgtggaaatgtttaacttttatttttt	6660
catttaaatttgctgttctggtattaccaaaccacacatttgtaccgaattggcagtaaa	6720
tgttagccatttacagcaatgccaaatatggagaaacatcataataaaaaaatctgcttt	6780
ttcatta                                                     	6787
 
 
<210>	666
<211>	5288
<212>	DNA
<213>	Macaca mulatta
 
<220>	 
<223>	cDNA sequence of rhesus monkey NR3C1

<300>
<308>	XM_001097015.1
<309>	2006-06-14
 
<400>	666
tgcgagcgcgcggcggcggcagctgaagacccggccgcccagacgatgcggtggtggggg	60
acctgccggcacgcgactgcccccgggcccaaattgatattcactgatggactccaaaga	120
atcattaactcccagtagagaagaaaaccccagcagtgtgcttgctcaggagaggggaaa	180
tgtgatggacttctataaaaccctaaggggaggagctactgtgaaggtttctgcatcttc	240
accctcactggctgtcgcttctcagtcagactccaagcagcgaagacttttggttgattt	300
tccaaaaggctcagtaagcaatgcgcagcagccagatctctccaaagcagtttcactctc	360
aatgggactgtatatgggagagacagaaacaaaagtgatgggaaatgacctgggattccc	420
acagcagggccaaatcagcctttcctcgggggaaacagacttaaagcttttggaagaaag	480
cattgcaaacctcaataggtcgaccagtgttccagagaaccccaagagttcagcatccac	540
tgctgtgtctgctgcccccacaaagaaggagtttccaaaaactcactctgatggatcttc	600
agaacagcaaaatttgaagggccatactggcaccaacggcggcaatgtgaaattgtatac	660
cgcagaccaaagcacctttgacattttgcaggatttggagttttcttctgggtccccagg	720
taaagagacgaatgagagtccttggagatcagacctgttgatagatgaaaactgtttgct	780
ttctcctctggcgggagaagacgattcattccttttggaaggaaattcgaatgaggactg	840
taagcctctcattttaccggacactaaacccaaaattaaggataatggagatctggtttt	900
gtcaagccccaataatgcaacactgccccaagtgaaaacagaaaaagaagatttcatcga	960
actctgcacccctggggtaattaagcaagagaaactgggcacagtttactgtcaggcaag	1020
ctttcctggagcaaatataattggtaataaaatgtctgccatttctgttcatggtgtgag	1080
tacctctggaggacagatgtaccactatgacatgaatacagcatccctttctcaacagca	1140
ggatcagaagcctatttttaatgtcattccaccaattcccgttggttctgaaaattggaa	1200
taggtgccaaggttctggagacgacaacttgacttccttggggactctgaacttccctgg	1260
tcgaacagttttttctaatggctattcaagccccagcatgagaccagatgtaagctctcc	1320
tccatccagctcctcaacagcaacaacaggaccacctccgaaactctgcctggtgtgctc	1380
tgatgaagcatcaggatgtcattatggagtcttaacttgtggaagctgtaaagttttctt	1440
caaaagagcagtggaaggacagcacaattacctatgtgctggaaggaatgattgcatcat	1500
cgataaaattcgaagaaaaaactgcccagcatgccgctatcgaaaatgtcttcaggctgg	1560
aatgaacctggaagctcgaaaaacaaagaaaaaaataaaaggaattcagcaggccactac	1620
aggagtctcacaagaaacctctgaaaatcctgctaacaaaacaatagttcctgcaacgtt	1680
accacaactcacccctaccctggtgtcactgttggaggttattgaacctgaagtgttata	1740
tgcaggatatgatagctctgttccagactcaacttggaggatcatgaccacgctcaacat	1800
gttaggagggcggcaagtgattgcagcagtgaaatgggcaaaagcgataccaggtttcag	1860
gaacttacacctggatgaccaaatgaccctactgcaatactcctggatgtttcttatggc	1920
atttgccctggggtggagatcatatagacaatcaagtgcaaacctgctgtgttttgctcc	1980
tgatctgattattaatgaatacacagcagagaagtcacgcatgtacgaccaatgtaaaca	2040
catgctgtatgtttcctctgagttacacaggcttcaggtatcttatgaagaatatctctg	2100
tatgaaaaccttactgcttttcttttttttctgcttgcttttccttttagttcctaaaga	2160
cggtctgaagagccaagagctatttgatgaaattagaatgacctacatcaaagagctagg	2220
aaaagccattgtcaagagggaaggaaactccagccagaactggcagcggttttatcaact	2280
gacaaaactcttggattctatgcatgaagtggttgaaaatcttcttaactattgcttcca	2340
aacatttttggataagaccatgagtattgaattcccagagatgttagctgaaatcatcac	2400
caatcagataccaaaatattcaaatggaaatatcaaaaaacttctgtttcatcaaaagtg	2460
actgccttaataagaatggttgccttaaagaaagtcgaattaatagcttttattgtataa	2520
actctcagtttgtcctgtagaggttttgttgttttattttttattgttttcgtctgttgt	2580
tttgttttaaatacgcactacatgtggtttatagagggccaagacttggcaacagaagca	2640
attgagtcatcacttttcagtgatgggagagtagacggtgaaatttcattaagttagtat	2700
atcccagaaattagaaaccttaatatgtggacgtaatctccatagtcaaagaaggatggc	2760
acctaaaccaccagtgcccaaagtctgtgtgatgaactttctgctcatactttttcacag	2820
ttggctggatgaaattttctagactttctgttggtgtatccccccctgtatagttaagat	2880
agcatttttgatttatgcatggaaacctgaaaaaagtttacaagtgtatatcagaaaagg	2940
gaagttgtgccttttatagctattactgtctggttttaacaatttcctttatatttagtg	3000
aactacgcttgctcattttttcttacataattttttattcaagttattgtacagctgttt	3060
aagatgggcagctagttcgtagctttcccaaataaactctaaacattaatcttctgtgtg	3120
aaaatgggttggtgcttctaacctgatggcacttagctatcagaagaccacaaaattgac	3180
tcaaatctccagtattcttgtcaaaaaaaagctcacattttgtatatatctgcttcagtg	3240
gagaattatataggttgtgcaaattcaccatcctaactggtatgagcacctagtccaggg	3300
acctgctgggtaaactgtggatgatggttgcaaaagactgatttaaaaatcactaccaag	3360
aggccctgtctgtacctaatgccctatttttgcaaaggctatatggcaagaaagctggta	3420
aactatttgtctttcaggaccttttgaagtagtttgtataacttcttaaaagttgtgatt	3480
ccagacaaccagctgtaacacagctgagagaattttaatcagagcaagtaattcctctca	3540
ctaaactttacccaaaaactaaatctctaatatggcaaaaatggctagacacccattttc	3600
acattcccatctgtcaccaattggttaatctttcctgatggtacaggaaagctcagctac	3660
tgatttttgtgatttagaactgtatgtcagacatccatgtttgtaaaactacacatccct	3720
aatgtgtgccatagagtttaacacaagtcctgtgaatttcttcactgttgaaaattattt	3780
taaacaaaatagaagctgtagtagccctttctgtgtgcaccttaccaactttctgtaaac	3840
tcaaaacttaacatatttactaagccacaagaaatttgatttctattcaaggtggccaaa	3900
ttatttgtgtaatagaaaactgaaaatctaatattaaaaatatggaacttctaatatatt	3960
tttatatttagttatagtttcagatatatatcatattggtattcactaatctgggaaggg	4020
aagggctactgcagctttacatgcaatttattaaaatgattgtaaaatagcttgtatagt	4080
gtaaaataagaatgatttttagatgagattgttttatcatgacatgttatatattttttg	4140
taggggtcaaagaaatgctgatggataacctatatgatttatagtttgtacatgcattca	4200
tacaggcagcgttggtctcagaacccaaacaatttgctctaggggaagagggagatggag	4260
actggtcctgtgtgcagtgaaggttgctgaggctctgacccaatgagattacagaggaag	4320
ttaccctctgcctcccattctgaccacccttctcattccaacagtgagtctgtcagtgca	4380
ggtttagtttactcaatctccccttgcactaaagtatgtaaacaggagacaggaaagtgg	4440
tgcttacatacttaaaggcaccatctaatagtgggttactttcacatacaggcctccccc	4500
agcagttgaatgacaacagaagtttggcaatagtttgcatagaggtaccagcaatatgta	4560
aatagtgcagaatctcataggttgccaataatacactaattcctttctatcctacaacaa	4620
gagtttatttccaaataaaatgaggacatgtttttgttttctttgaatgctttttgaatg	4680
ttatttgttattttcagtattttggagaaattatttaataaaaaacaatcatttgctttt	4740
tgaatgctctctaaaagggaatgtaatattttaagatggtttgtaacccagctggataaa	4800
tttttggtgcctaagaaaactgcttgaatatttttatcaatgacagtgttaagtttcaaa	4860
aagagcttctacaatgtagattatcattcatttatagaacgttatgtggttaaaaccaga	4920
aagcacatctcacacattaatctgattttcgtcccaacaatcttggcgctcaaaaaatag	4980
aactcaatgaaaaaaagattatgtgtactttgctgtcaataataagtcaactgatattca	5040
tcaacaactataggaggcttttcattaaatgggaaaagaagctgtgcccttttagaatac	5100
atgggggaaaagaaagtcatcttaattatgtttaactagggacttaagtgctatagggtg	5160
gtgctgtttgaaagcagctttatttcctatgtatgtgttatctggttatcccaacccaaa	5220
ctattgaagtttgtagtaacttcagtgagagttggttactcacaacaaatcctgaaaagt	5280
atttttaa                                                    	5288
 
 
<210>	667
<211>	5258
<212>	DNA
<213>	Macaca mulatta
 
<220>	 
<223>	cDNA sequence of rhesus monkey NR3C1

<300>
<308>	XM_001097126.1
<309>	2006-06-14
 
<400>	667
tgcgagcgcgcggcggcggcagctgaagacccggccgcccagacgatgcggtggtggggg	60
acctgccggcacgcgactgcccccgggcccaaattgatattcactgatggactccaaaga	120
atcattaactcccagtagagaagaaaaccccagcagtgtgcttgctcaggagaggggaaa	180
tgtgatggacttctataaaaccctaaggggaggagctactgtgaaggtttctgcatcttc	240
accctcactggctgtcgcttctcagtcagactccaagcagcgaagacttttggttgattt	300
tccaaaaggctcagtaagcaatgcgcagcagccagatctctccaaagcagtttcactctc	360
aatgggactgtatatgggagagacagaaacaaaagtgatgggaaatgacctgggattccc	420
acagcagggccaaatcagcctttcctcgggggaaacagacttaaagcttttggaagaaag	480
cattgcaaacctcaataggtcgaccagtgttccagagaaccccaagagttcagcatccac	540
tgctgtgtctgctgcccccacaaagaaggagtttccaaaaactcactctgatggatcttc	600
agaacagcaaaatttgaagggccatactggcaccaacggcggcaatgtgaaattgtatac	660
cgcagaccaaagcacctttgacattttgcaggatttggagttttcttctgggtccccagg	720
taaagagacgaatgagagtccttggagatcagacctgttgatagatgaaaactgtttgct	780
ttctcctctggcgggagaagacgattcattccttttggaaggaaattcgaatgaggactg	840
taagcctctcattttaccggacactaaacccaaaattaaggataatggagatctggtttt	900
gtcaagccccaataatgcaacactgccccaagtgaaaacagaaaaagaagatttcatcga	960
actctgcacccctggggtaattaagcaagagaaactgggcacagtttactgtcaggcaag	1020
ctttcctggagcaaatataattggtaataaaatgtctgccatttctgttcatggtgtgag	1080
tacctctggaggacagatgtaccactatgacatgaatacagcatccctttctcaacagca	1140
ggatcagaagcctatttttaatgtcattccaccaattcccgttggttctgaaaattggaa	1200
taggtgccaaggttctggagacgacaacttgacttccttggggactctgaacttccctgg	1260
tcgaacagttttttctaatggctattcaagccccagcatgagaccagatgtaagctctcc	1320
tccatccagctcctcaacagcaacaacaggaccacctccgaaactctgcctggtgtgctc	1380
tgatgaagcatcaggatgtcattatggagtcttaacttgtggaagctgtaaagttttctt	1440
caaaagagcagtggaaggacagcacaattacctatgtgctggaaggaatgattgcatcat	1500
cgataaaattcgaagaaaaaactgcccagcatgccgctatcgaaaatgtcttcaggctgg	1560
aatgaacctggaagctcgaaaaacaaagaaaaaaataaaaggaattcagcaggccactac	1620
aggagtctcacaagaaacctctgaaaatcctgctaacaaaacaatagttcctgcaacgtt	1680
accacaactcacccctaccctggtgtcactgttggaggttattgaacctgaagtgttata	1740
tgcaggatatgatagctctgttccagactcaacttggaggatcatgaccacgctcaacat	1800
gttaggagggcggcaagtgattgcagcagtgaaatgggcaaaagcgataccaggtttcag	1860
gaacttacacctggatgaccaaatgaccctactgcaatactcctggatgtttcttatggc	1920
atttgccctggggtggagatcatatagacaatcaagtgcaaacctgctgtgttttgctcc	1980
tgatctgattattaatgagactctaccctgcatgtacgaccaatgtaaacacatgctgta	2040
tgtttcctctgagttacacaggcttcaggtatcttatgaagaatatctctgtatgaaaac	2100
cttactgcttctctcttcagttcctaaagacggtctgaagagccaagagctatttgatga	2160
aattagaatgacctacatcaaagagctaggaaaagccattgtcaagagggaaggaaactc	2220
cagccagaactggcagcggttttatcaactgacaaaactcttggattctatgcatgaagt	2280
ggttgaaaatcttcttaactattgcttccaaacatttttggataagaccatgagtattga	2340
attcccagagatgttagctgaaatcatcaccaatcagataccaaaatattcaaatggaaa	2400
tatcaaaaaacttctgtttcatcaaaagtgactgccttaataagaatggttgccttaaag	2460
aaagtcgaattaatagcttttattgtataaactctcagtttgtcctgtagaggttttgtt	2520
gttttattttttattgttttcgtctgttgttttgttttaaatacgcactacatgtggttt	2580
atagagggccaagacttggcaacagaagcaattgagtcatcacttttcagtgatgggaga	2640
gtagacggtgaaatttcattaagttagtatatcccagaaattagaaaccttaatatgtgg	2700
acgtaatctccatagtcaaagaaggatggcacctaaaccaccagtgcccaaagtctgtgt	2760
gatgaactttctgctcatactttttcacagttggctggatgaaattttctagactttctg	2820
ttggtgtatccccccctgtatagttaagatagcatttttgatttatgcatggaaacctga	2880
aaaaagtttacaagtgtatatcagaaaagggaagttgtgccttttatagctattactgtc	2940
tggttttaacaatttcctttatatttagtgaactacgcttgctcattttttcttacataa	3000
ttttttattcaagttattgtacagctgtttaagatgggcagctagttcgtagctttccca	3060
aataaactctaaacattaatcttctgtgtgaaaatgggttggtgcttctaacctgatggc	3120
acttagctatcagaagaccacaaaattgactcaaatctccagtattcttgtcaaaaaaaa	3180
gctcacattttgtatatatctgcttcagtggagaattatataggttgtgcaaattcacca	3240
tcctaactggtatgagcacctagtccagggacctgctgggtaaactgtggatgatggttg	3300
caaaagactgatttaaaaatcactaccaagaggccctgtctgtacctaatgccctatttt	3360
tgcaaaggctatatggcaagaaagctggtaaactatttgtctttcaggaccttttgaagt	3420
agtttgtataacttcttaaaagttgtgattccagacaaccagctgtaacacagctgagag	3480
aattttaatcagagcaagtaattcctctcactaaactttacccaaaaactaaatctctaa	3540
tatggcaaaaatggctagacacccattttcacattcccatctgtcaccaattggttaatc	3600
tttcctgatggtacaggaaagctcagctactgatttttgtgatttagaactgtatgtcag	3660
acatccatgtttgtaaaactacacatccctaatgtgtgccatagagtttaacacaagtcc	3720
tgtgaatttcttcactgttgaaaattattttaaacaaaatagaagctgtagtagcccttt	3780
ctgtgtgcaccttaccaactttctgtaaactcaaaacttaacatatttactaagccacaa	3840
gaaatttgatttctattcaaggtggccaaattatttgtgtaatagaaaactgaaaatcta	3900
atattaaaaatatggaacttctaatatatttttatatttagttatagtttcagatatata	3960
tcatattggtattcactaatctgggaagggaagggctactgcagctttacatgcaattta	4020
ttaaaatgattgtaaaatagcttgtatagtgtaaaataagaatgatttttagatgagatt	4080
gttttatcatgacatgttatatattttttgtaggggtcaaagaaatgctgatggataacc	4140
tatatgatttatagtttgtacatgcattcatacaggcagcgttggtctcagaacccaaac	4200
aatttgctctaggggaagagggagatggagactggtcctgtgtgcagtgaaggttgctga	4260
ggctctgacccaatgagattacagaggaagttaccctctgcctcccattctgaccaccct	4320
tctcattccaacagtgagtctgtcagtgcaggtttagtttactcaatctccccttgcact	4380
aaagtatgtaaacaggagacaggaaagtggtgcttacatacttaaaggcaccatctaata	4440
gtgggttactttcacatacaggcctcccccagcagttgaatgacaacagaagtttggcaa	4500
tagtttgcatagaggtaccagcaatatgtaaatagtgcagaatctcataggttgccaata	4560
atacactaattcctttctatcctacaacaagagtttatttccaaataaaatgaggacatg	4620
tttttgttttctttgaatgctttttgaatgttatttgttattttcagtattttggagaaa	4680
ttatttaataaaaaacaatcatttgctttttgaatgctctctaaaagggaatgtaatatt	4740
ttaagatggtttgtaacccagctggataaatttttggtgcctaagaaaactgcttgaata	4800
tttttatcaatgacagtgttaagtttcaaaaagagcttctacaatgtagattatcattca	4860
tttatagaacgttatgtggttaaaaccagaaagcacatctcacacattaatctgattttc	4920
gtcccaacaatcttggcgctcaaaaaatagaactcaatgaaaaaaagattatgtgtactt	4980
tgctgtcaataataagtcaactgatattcatcaacaactataggaggcttttcattaaat	5040
gggaaaagaagctgtgcccttttagaatacatgggggaaaagaaagtcatcttaattatg	5100
tttaactagggacttaagtgctatagggtggtgctgtttgaaagcagctttatttcctat	5160
gtatgtgttatctggttatcccaacccaaactattgaagtttgtagtaacttcagtgaga	5220
gttggttactcacaacaaatcctgaaaagtatttttaa                         	5258
 
 
<210>	668
<211>	5223
<212>	DNA
<213>	Macaca mulatta
 
<220>	 
<223>	cDNA sequence of rhesus monkey NR3C1

<300>
<308>	XM_001097238.1
<309>	2006-06-14 
  
<400>	668
aatccagctcgctggaggttttgcgtttggcgtgcaacttccttcgagtttgatattcac	60
tgatggactccaaagaatcattaactcccagtagagaagaaaaccccagcagtgtgcttg	120
ctcaggagaggggaaatgtgatggacttctataaaaccctaaggggaggagctactgtga	180
aggtttctgcatcttcaccctcactggctgtcgcttctcagtcagactccaagcagcgaa	240
gacttttggttgattttccaaaaggctcagtaagcaatgcgcagcagccagatctctcca	300
aagcagtttcactctcaatgggactgtatatgggagagacagaaacaaaagtgatgggaa	360
atgacctgggattcccacagcagggccaaatcagcctttcctcgggggaaacagacttaa	420
agcttttggaagaaagcattgcaaacctcaataggtcgaccagtgttccagagaacccca	480
agagttcagcatccactgctgtgtctgctgcccccacaaagaaggagtttccaaaaactc	540
actctgatggatcttcagaacagcaaaatttgaagggccatactggcaccaacggcggca	600
atgtgaaattgtataccgcagaccaaagcacctttgacattttgcaggatttggagtttt	660
cttctgggtccccaggtaaagagacgaatgagagtccttggagatcagacctgttgatag	720
atgaaaactgtttgctttctcctctggcgggagaagacgattcattccttttggaaggaa	780
attcgaatgaggactgtaagcctctcattttaccggacactaaacccaaaattaaggata	840
atggagatctggttttgtcaagccccaataatgcaacactgccccaagtgaaaacagaaa	900
aagaagatttcatcgaactctgcacccctggggtaattaagcaagagaaactgggcacag	960
tttactgtcaggcaagctttcctggagcaaatataattggtaataaaatgtctgccattt	1020
ctgttcatggtgtgagtacctctggaggacagatgtaccactatgacatgaatacagcat	1080
ccctttctcaacagcaggatcagaagcctatttttaatgtcattccaccaattcccgttg	1140
gttctgaaaattggaataggtgccaaggttctggagacgacaacttgacttccttgggga	1200
ctctgaacttccctggtcgaacagttttttctaatggctattcaagccccagcatgagac	1260
cagatgtaagctctcctccatccagctcctcaacagcaacaacaggaccacctccgaaac	1320
tctgcctggtgtgctctgatgaagcatcaggatgtcattatggagtcttaacttgtggaa	1380
gctgtaaagttttcttcaaaagagcagtggaaggacagcacaattacctatgtgctggaa	1440
ggaatgattgcatcatcgataaaattcgaagaaaaaactgcccagcatgccgctatcgaa	1500
aatgtcttcaggctggaatgaacctggaagctcgaaaaacaaagaaaaaaataaaaggaa	1560
ttcagcaggccactacaggagtctcacaagaaacctctgaaaatcctgctaacaaaacaa	1620
tagttcctgcaacgttaccacaactcacccctaccctggtgtcactgttggaggttattg	1680
aacctgaagtgttatatgcaggatatgatagctctgttccagactcaacttggaggatca	1740
tgaccacgctcaacatgttaggagggcggcaagtgattgcagcagtgaaatgggcaaaag	1800
cgataccaggtttcaggaacttacacctggatgaccaaatgaccctactgcaatactcct	1860
ggatgtttcttatggcatttgccctggggtggagatcatatagacaatcaagtgcaaacc	1920
tgctgtgttttgctcctgatctgattattaatgaatacacagcagagaagtcacgcatgt	1980
acgaccaatgtaaacacatgctgtatgtttcctctgagttacacaggcttcaggtatctt	2040
atgaagaatatctctgtatgaaaaccttactgcttctctcttcagttcctaaagacggtc	2100
tgaagagccaagagctatttgatgaaattagaatgacctacatcaaagagctaggaaaag	2160
ccattgtcaagagggaaggaaactccagccagaactggcagcggttttatcaactgacaa	2220
aactcttggattctatgcatgaagtggttgaaaatcttcttaactattgcttccaaacat	2280
ttttggataagaccatgagtattgaattcccagagatgttagctgaaatcatcaccaatc	2340
agataccaaaatattcaaatggaaatatcaaaaaacttctgtttcatcaaaagtgactgc	2400
cttaataagaatggttgccttaaagaaagtcgaattaatagcttttattgtataaactct	2460
cagtttgtcctgtagaggttttgttgttttattttttattgttttcgtctgttgttttgt	2520
tttaaatacgcactacatgtggtttatagagggccaagacttggcaacagaagcaattga	2580
gtcatcacttttcagtgatgggagagtagacggtgaaatttcattaagttagtatatccc	2640
agaaattagaaaccttaatatgtggacgtaatctccatagtcaaagaaggatggcaccta	2700
aaccaccagtgcccaaagtctgtgtgatgaactttctgctcatactttttcacagttggc	2760
tggatgaaattttctagactttctgttggtgtatccccccctgtatagttaagatagcat	2820
ttttgatttatgcatggaaacctgaaaaaagtttacaagtgtatatcagaaaagggaagt	2880
tgtgccttttatagctattactgtctggttttaacaatttcctttatatttagtgaacta	2940
cgcttgctcattttttcttacataattttttattcaagttattgtacagctgtttaagat	3000
gggcagctagttcgtagctttcccaaataaactctaaacattaatcttctgtgtgaaaat	3060
gggttggtgcttctaacctgatggcacttagctatcagaagaccacaaaattgactcaaa	3120
tctccagtattcttgtcaaaaaaaagctcacattttgtatatatctgcttcagtggagaa	3180
ttatataggttgtgcaaattcaccatcctaactggtatgagcacctagtccagggacctg	3240
ctgggtaaactgtggatgatggttgcaaaagactgatttaaaaatcactaccaagaggcc	3300
ctgtctgtacctaatgccctatttttgcaaaggctatatggcaagaaagctggtaaacta	3360
tttgtctttcaggaccttttgaagtagtttgtataacttcttaaaagttgtgattccaga	3420
caaccagctgtaacacagctgagagaattttaatcagagcaagtaattcctctcactaaa	3480
ctttacccaaaaactaaatctctaatatggcaaaaatggctagacacccattttcacatt	3540
cccatctgtcaccaattggttaatctttcctgatggtacaggaaagctcagctactgatt	3600
tttgtgatttagaactgtatgtcagacatccatgtttgtaaaactacacatccctaatgt	3660
gtgccatagagtttaacacaagtcctgtgaatttcttcactgttgaaaattattttaaac	3720
aaaatagaagctgtagtagccctttctgtgtgcaccttaccaactttctgtaaactcaaa	3780
acttaacatatttactaagccacaagaaatttgatttctattcaaggtggccaaattatt	3840
tgtgtaatagaaaactgaaaatctaatattaaaaatatggaacttctaatatatttttat	3900
atttagttatagtttcagatatatatcatattggtattcactaatctgggaagggaaggg	3960
ctactgcagctttacatgcaatttattaaaatgattgtaaaatagcttgtatagtgtaaa	4020
ataagaatgatttttagatgagattgttttatcatgacatgttatatattttttgtaggg	4080
gtcaaagaaatgctgatggataacctatatgatttatagtttgtacatgcattcatacag	4140
gcagcgttggtctcagaacccaaacaatttgctctaggggaagagggagatggagactgg	4200
tcctgtgtgcagtgaaggttgctgaggctctgacccaatgagattacagaggaagttacc	4260
ctctgcctcccattctgaccacccttctcattccaacagtgagtctgtcagtgcaggttt	4320
agtttactcaatctccccttgcactaaagtatgtaaacaggagacaggaaagtggtgctt	4380
acatacttaaaggcaccatctaatagtgggttactttcacatacaggcctcccccagcag	4440
ttgaatgacaacagaagtttggcaatagtttgcatagaggtaccagcaatatgtaaatag	4500
tgcagaatctcataggttgccaataatacactaattcctttctatcctacaacaagagtt	4560
tatttccaaataaaatgaggacatgtttttgttttctttgaatgctttttgaatgttatt	4620
tgttattttcagtattttggagaaattatttaataaaaaacaatcatttgctttttgaat	4680
gctctctaaaagggaatgtaatattttaagatggtttgtaacccagctggataaattttt	4740
ggtgcctaagaaaactgcttgaatatttttatcaatgacagtgttaagtttcaaaaagag	4800
cttctacaatgtagattatcattcatttatagaacgttatgtggttaaaaccagaaagca	4860
catctcacacattaatctgattttcgtcccaacaatcttggcgctcaaaaaatagaactc	4920
aatgaaaaaaagattatgtgtactttgctgtcaataataagtcaactgatattcatcaac	4980
aactataggaggcttttcattaaatgggaaaagaagctgtgcccttttagaatacatggg	5040
ggaaaagaaagtcatcttaattatgtttaactagggacttaagtgctatagggtggtgct	5100
gtttgaaagcagctttatttcctatgtatgtgttatctggttatcccaacccaaactatt	5160
gaagtttgtagtaacttcagtgagagttggttactcacaacaaatcctgaaaagtatttt	5220
taa                                                         	5223
 
 
<210>	669
<211>	5236
<212>	DNA
<213>	Macaca mulatta
 
<220>	 
<223>	cDNA sequence of rhesus monkey NR3C1

<300>
<308>	XM_001097341.1
<309>	2006-06-14 
  
<400>	669
gtagtgagaagagaaactggagaaactcggtggccctcctaacgccgccccagatagacc	60
agttgatattcactgatggactccaaagaatcattaactcccagtagagaagaaaacccc	120
agcagtgtgcttgctcaggagaggggaaatgtgatggacttctataaaaccctaagggga	180
ggagctactgtgaaggtttctgcatcttcaccctcactggctgtcgcttctcagtcagac	240
tccaagcagcgaagacttttggttgattttccaaaaggctcagtaagcaatgcgcagcag	300
ccagatctctccaaagcagtttcactctcaatgggactgtatatgggagagacagaaaca	360
aaagtgatgggaaatgacctgggattcccacagcagggccaaatcagcctttcctcgggg	420
gaaacagacttaaagcttttggaagaaagcattgcaaacctcaataggtcgaccagtgtt	480
ccagagaaccccaagagttcagcatccactgctgtgtctgctgcccccacaaagaaggag	540
tttccaaaaactcactctgatggatcttcagaacagcaaaatttgaagggccatactggc	600
accaacggcggcaatgtgaaattgtataccgcagaccaaagcacctttgacattttgcag	660
gatttggagttttcttctgggtccccaggtaaagagacgaatgagagtccttggagatca	720
gacctgttgatagatgaaaactgtttgctttctcctctggcgggagaagacgattcattc	780
cttttggaaggaaattcgaatgaggactgtaagcctctcattttaccggacactaaaccc	840
aaaattaaggataatggagatctggttttgtcaagccccaataatgcaacactgccccaa	900
gtgaaaacagaaaaagaagatttcatcgaactctgcacccctggggtaattaagcaagag	960
aaactgggcacagtttactgtcaggcaagctttcctggagcaaatataattggtaataaa	1020
atgtctgccatttctgttcatggtgtgagtacctctggaggacagatgtaccactatgac	1080
atgaatacagcatccctttctcaacagcaggatcagaagcctatttttaatgtcattcca	1140
ccaattcccgttggttctgaaaattggaataggtgccaaggttctggagacgacaacttg	1200
acttccttggggactctgaacttccctggtcgaacagttttttctaatggctattcaagc	1260
cccagcatgagaccagatgtaagctctcctccatccagctcctcaacagcaacaacagga	1320
ccacctccgaaactctgcctggtgtgctctgatgaagcatcaggatgtcattatggagtc	1380
ttaacttgtggaagctgtaaagttttcttcaaaagagcagtggaaggacagcacaattac	1440
ctatgtgctggaaggaatgattgcatcatcgataaaattcgaagaaaaaactgcccagca	1500
tgccgctatcgaaaatgtcttcaggctggaatgaacctggaagctcgaaaaacaaagaaa	1560
aaaataaaaggaattcagcaggccactacaggagtctcacaagaaacctctgaaaatcct	1620
gctaacaaaacaatagttcctgcaacgttaccacaactcacccctaccctggtgtcactg	1680
ttggaggttattgaacctgaagtgttatatgcaggatatgatagctctgttccagactca	1740
acttggaggatcatgaccacgctcaacatgttaggagggcggcaagtgattgcagcagtg	1800
aaatgggcaaaagcgataccaggtttcaggaacttacacctggatgaccaaatgacccta	1860
ctgcaatactcctggatgtttcttatggcatttgccctggggtggagatcatatagacaa	1920
tcaagtgcaaacctgctgtgttttgctcctgatctgattattaatgaatacacagcagag	1980
aagtcacgcatgtacgaccaatgtaaacacatgctgtatgtttcctctgagttacacagg	2040
cttcaggtatcttatgaagaatatctctgtatgaaaaccttactgcttctctcttcagtt	2100
cctaaagacggtctgaagagccaagagctatttgatgaaattagaatgacctacatcaaa	2160
gagctaggaaaagccattgtcaagagggaaggaaactccagccagaactggcagcggttt	2220
tatcaactgacaaaactcttggattctatgcatgaagtggttgaaaatcttcttaactat	2280
tgcttccaaacatttttggataagaccatgagtattgaattcccagagatgttagctgaa	2340
atcatcaccaatcagataccaaaatattcaaatggaaatatcaaaaaacttctgtttcat	2400
caaaagtgactgccttaataagaatggttgccttaaagaaagtcgaattaatagctttta	2460
ttgtataaactctcagtttgtcctgtagaggttttgttgttttattttttattgttttcg	2520
tctgttgttttgttttaaatacgcactacatgtggtttatagagggccaagacttggcaa	2580
cagaagcaattgagtcatcacttttcagtgatgggagagtagacggtgaaatttcattaa	2640
gttagtatatcccagaaattagaaaccttaatatgtggacgtaatctccatagtcaaaga	2700
aggatggcacctaaaccaccagtgcccaaagtctgtgtgatgaactttctgctcatactt	2760
tttcacagttggctggatgaaattttctagactttctgttggtgtatccccccctgtata	2820
gttaagatagcatttttgatttatgcatggaaacctgaaaaaagtttacaagtgtatatc	2880
agaaaagggaagttgtgccttttatagctattactgtctggttttaacaatttcctttat	2940
atttagtgaactacgcttgctcattttttcttacataattttttattcaagttattgtac	3000
agctgtttaagatgggcagctagttcgtagctttcccaaataaactctaaacattaatct	3060
tctgtgtgaaaatgggttggtgcttctaacctgatggcacttagctatcagaagaccaca	3120
aaattgactcaaatctccagtattcttgtcaaaaaaaagctcacattttgtatatatctg	3180
cttcagtggagaattatataggttgtgcaaattcaccatcctaactggtatgagcaccta	3240
gtccagggacctgctgggtaaactgtggatgatggttgcaaaagactgatttaaaaatca	3300
ctaccaagaggccctgtctgtacctaatgccctatttttgcaaaggctatatggcaagaa	3360
agctggtaaactatttgtctttcaggaccttttgaagtagtttgtataacttcttaaaag	3420
ttgtgattccagacaaccagctgtaacacagctgagagaattttaatcagagcaagtaat	3480
tcctctcactaaactttacccaaaaactaaatctctaatatggcaaaaatggctagacac	3540
ccattttcacattcccatctgtcaccaattggttaatctttcctgatggtacaggaaagc	3600
tcagctactgatttttgtgatttagaactgtatgtcagacatccatgtttgtaaaactac	3660
acatccctaatgtgtgccatagagtttaacacaagtcctgtgaatttcttcactgttgaa	3720
aattattttaaacaaaatagaagctgtagtagccctttctgtgtgcaccttaccaacttt	3780
ctgtaaactcaaaacttaacatatttactaagccacaagaaatttgatttctattcaagg	3840
tggccaaattatttgtgtaatagaaaactgaaaatctaatattaaaaatatggaacttct	3900
aatatatttttatatttagttatagtttcagatatatatcatattggtattcactaatct	3960
gggaagggaagggctactgcagctttacatgcaatttattaaaatgattgtaaaatagct	4020
tgtatagtgtaaaataagaatgatttttagatgagattgttttatcatgacatgttatat	4080
attttttgtaggggtcaaagaaatgctgatggataacctatatgatttatagtttgtaca	4140
tgcattcatacaggcagcgttggtctcagaacccaaacaatttgctctaggggaagaggg	4200
agatggagactggtcctgtgtgcagtgaaggttgctgaggctctgacccaatgagattac	4260
agaggaagttaccctctgcctcccattctgaccacccttctcattccaacagtgagtctg	4320
tcagtgcaggtttagtttactcaatctccccttgcactaaagtatgtaaacaggagacag	4380
gaaagtggtgcttacatacttaaaggcaccatctaatagtgggttactttcacatacagg	4440
cctcccccagcagttgaatgacaacagaagtttggcaatagtttgcatagaggtaccagc	4500
aatatgtaaatagtgcagaatctcataggttgccaataatacactaattcctttctatcc	4560
tacaacaagagtttatttccaaataaaatgaggacatgtttttgttttctttgaatgctt	4620
tttgaatgttatttgttattttcagtattttggagaaattatttaataaaaaacaatcat	4680
ttgctttttgaatgctctctaaaagggaatgtaatattttaagatggtttgtaacccagc	4740
tggataaatttttggtgcctaagaaaactgcttgaatatttttatcaatgacagtgttaa	4800
gtttcaaaaagagcttctacaatgtagattatcattcatttatagaacgttatgtggtta	4860
aaaccagaaagcacatctcacacattaatctgattttcgtcccaacaatcttggcgctca	4920
aaaaatagaactcaatgaaaaaaagattatgtgtactttgctgtcaataataagtcaact	4980
gatattcatcaacaactataggaggcttttcattaaatgggaaaagaagctgtgcccttt	5040
tagaatacatgggggaaaagaaagtcatcttaattatgtttaactagggacttaagtgct	5100
atagggtggtgctgtttgaaagcagctttatttcctatgtatgtgttatctggttatccc	5160
aacccaaactattgaagtttgtagtaacttcagtgagagttggttactcacaacaaatcc	5220
tgaaaagtatttttaa                                            	5236
 
 
<210>	670
<211>	5272
<212>	DNA
<213>	Macaca mulatta
 
<220>	 
<223>	cDNA sequence of rhesus monkey NR3C1

<300>
<308>	XM_001097444.1
<309>	2006-06-14 
  
<400>	670
cgtgcaggcgccgtcggggccggggtggcggggcccgcgcgtagggcgtgggggcaggga	60
ccgcgggcgcccctgcagttgccaagcgtcgccaacagttgatattcactgatggactcc	120
aaagaatcattaactcccagtagagaagaaaaccccagcagtgtgcttgctcaggagagg	180
ggaaatgtgatggacttctataaaaccctaaggggaggagctactgtgaaggtttctgca	240
tcttcaccctcactggctgtcgcttctcagtcagactccaagcagcgaagacttttggtt	300
gattttccaaaaggctcagtaagcaatgcgcagcagccagatctctccaaagcagtttca	360
ctctcaatgggactgtatatgggagagacagaaacaaaagtgatgggaaatgacctggga	420
ttcccacagcagggccaaatcagcctttcctcgggggaaacagacttaaagcttttggaa	480
gaaagcattgcaaacctcaataggtcgaccagtgttccagagaaccccaagagttcagca	540
tccactgctgtgtctgctgcccccacaaagaaggagtttccaaaaactcactctgatgga	600
tcttcagaacagcaaaatttgaagggccatactggcaccaacggcggcaatgtgaaattg	660
tataccgcagaccaaagcacctttgacattttgcaggatttggagttttcttctgggtcc	720
ccaggtaaagagacgaatgagagtccttggagatcagacctgttgatagatgaaaactgt	780
ttgctttctcctctggcgggagaagacgattcattccttttggaaggaaattcgaatgag	840
gactgtaagcctctcattttaccggacactaaacccaaaattaaggataatggagatctg	900
gttttgtcaagccccaataatgcaacactgccccaagtgaaaacagaaaaagaagatttc	960
atcgaactctgcacccctggggtaattaagcaagagaaactgggcacagtttactgtcag	1020
gcaagctttcctggagcaaatataattggtaataaaatgtctgccatttctgttcatggt	1080
gtgagtacctctggaggacagatgtaccactatgacatgaatacagcatccctttctcaa	1140
cagcaggatcagaagcctatttttaatgtcattccaccaattcccgttggttctgaaaat	1200
tggaataggtgccaaggttctggagacgacaacttgacttccttggggactctgaacttc	1260
cctggtcgaacagttttttctaatggctattcaagccccagcatgagaccagatgtaagc	1320
tctcctccatccagctcctcaacagcaacaacaggaccacctccgaaactctgcctggtg	1380
tgctctgatgaagcatcaggatgtcattatggagtcttaacttgtggaagctgtaaagtt	1440
ttcttcaaaagagcagtggaaggacagcacaattacctatgtgctggaaggaatgattgc	1500
atcatcgataaaattcgaagaaaaaactgcccagcatgccgctatcgaaaatgtcttcag	1560
gctggaatgaacctggaagctcgaaaaacaaagaaaaaaataaaaggaattcagcaggcc	1620
actacaggagtctcacaagaaacctctgaaaatcctgctaacaaaacaatagttcctgca	1680
acgttaccacaactcacccctaccctggtgtcactgttggaggttattgaacctgaagtg	1740
ttatatgcaggatatgatagctctgttccagactcaacttggaggatcatgaccacgctc	1800
aacatgttaggagggcggcaagtgattgcagcagtgaaatgggcaaaagcgataccaggt	1860
ttcaggaacttacacctggatgaccaaatgaccctactgcaatactcctggatgtttctt	1920
atggcatttgccctggggtggagatcatatagacaatcaagtgcaaacctgctgtgtttt	1980
gctcctgatctgattattaatgaatacacagcagagaagtcacgcatgtacgaccaatgt	2040
aaacacatgctgtatgtttcctctgagttacacaggcttcaggtatcttatgaagaatat	2100
ctctgtatgaaaaccttactgcttctctcttcagttcctaaagacggtctgaagagccaa	2160
gagctatttgatgaaattagaatgacctacatcaaagagctaggaaaagccattgtcaag	2220
agggaaggaaactccagccagaactggcagcggttttatcaactgacaaaactcttggat	2280
tctatgcatgaagtggttgaaaatcttcttaactattgcttccaaacatttttggataag	2340
accatgagtattgaattcccagagatgttagctgaaatcatcaccaatcagataccaaaa	2400
tattcaaatggaaatatcaaaaaacttctgtttcatcaaaagtgactgccttaataagaa	2460
tggttgccttaaagaaagtcgaattaatagcttttattgtataaactctcagtttgtcct	2520
gtagaggttttgttgttttattttttattgttttcgtctgttgttttgttttaaatacgc	2580
actacatgtggtttatagagggccaagacttggcaacagaagcaattgagtcatcacttt	2640
tcagtgatgggagagtagacggtgaaatttcattaagttagtatatcccagaaattagaa	2700
accttaatatgtggacgtaatctccatagtcaaagaaggatggcacctaaaccaccagtg	2760
cccaaagtctgtgtgatgaactttctgctcatactttttcacagttggctggatgaaatt	2820
ttctagactttctgttggtgtatccccccctgtatagttaagatagcatttttgatttat	2880
gcatggaaacctgaaaaaagtttacaagtgtatatcagaaaagggaagttgtgcctttta	2940
tagctattactgtctggttttaacaatttcctttatatttagtgaactacgcttgctcat	3000
tttttcttacataattttttattcaagttattgtacagctgtttaagatgggcagctagt	3060
tcgtagctttcccaaataaactctaaacattaatcttctgtgtgaaaatgggttggtgct	3120
tctaacctgatggcacttagctatcagaagaccacaaaattgactcaaatctccagtatt	3180
cttgtcaaaaaaaagctcacattttgtatatatctgcttcagtggagaattatataggtt	3240
gtgcaaattcaccatcctaactggtatgagcacctagtccagggacctgctgggtaaact	3300
gtggatgatggttgcaaaagactgatttaaaaatcactaccaagaggccctgtctgtacc	3360
taatgccctatttttgcaaaggctatatggcaagaaagctggtaaactatttgtctttca	3420
ggaccttttgaagtagtttgtataacttcttaaaagttgtgattccagacaaccagctgt	3480
aacacagctgagagaattttaatcagagcaagtaattcctctcactaaactttacccaaa	3540
aactaaatctctaatatggcaaaaatggctagacacccattttcacattcccatctgtca	3600
ccaattggttaatctttcctgatggtacaggaaagctcagctactgatttttgtgattta	3660
gaactgtatgtcagacatccatgtttgtaaaactacacatccctaatgtgtgccatagag	3720
tttaacacaagtcctgtgaatttcttcactgttgaaaattattttaaacaaaatagaagc	3780
tgtagtagccctttctgtgtgcaccttaccaactttctgtaaactcaaaacttaacatat	3840
ttactaagccacaagaaatttgatttctattcaaggtggccaaattatttgtgtaataga	3900
aaactgaaaatctaatattaaaaatatggaacttctaatatatttttatatttagttata	3960
gtttcagatatatatcatattggtattcactaatctgggaagggaagggctactgcagct	4020
ttacatgcaatttattaaaatgattgtaaaatagcttgtatagtgtaaaataagaatgat	4080
ttttagatgagattgttttatcatgacatgttatatattttttgtaggggtcaaagaaat	4140
gctgatggataacctatatgatttatagtttgtacatgcattcatacaggcagcgttggt	4200
ctcagaacccaaacaatttgctctaggggaagagggagatggagactggtcctgtgtgca	4260
gtgaaggttgctgaggctctgacccaatgagattacagaggaagttaccctctgcctccc	4320
attctgaccacccttctcattccaacagtgagtctgtcagtgcaggtttagtttactcaa	4380
tctccccttgcactaaagtatgtaaacaggagacaggaaagtggtgcttacatacttaaa	4440
ggcaccatctaatagtgggttactttcacatacaggcctcccccagcagttgaatgacaa	4500
cagaagtttggcaatagtttgcatagaggtaccagcaatatgtaaatagtgcagaatctc	4560
ataggttgccaataatacactaattcctttctatcctacaacaagagtttatttccaaat	4620
aaaatgaggacatgtttttgttttctttgaatgctttttgaatgttatttgttattttca	4680
gtattttggagaaattatttaataaaaaacaatcatttgctttttgaatgctctctaaaa	4740
gggaatgtaatattttaagatggtttgtaacccagctggataaatttttggtgcctaaga	4800
aaactgcttgaatatttttatcaatgacagtgttaagtttcaaaaagagcttctacaatg	4860
tagattatcattcatttatagaacgttatgtggttaaaaccagaaagcacatctcacaca	4920
ttaatctgattttcgtcccaacaatcttggcgctcaaaaaatagaactcaatgaaaaaaa	4980
gattatgtgtactttgctgtcaataataagtcaactgatattcatcaacaactataggag	5040
gcttttcattaaatgggaaaagaagctgtgcccttttagaatacatgggggaaaagaaag	5100
tcatcttaattatgtttaactagggacttaagtgctatagggtggtgctgtttgaaagca	5160
gctttatttcctatgtatgtgttatctggttatcccaacccaaactattgaagtttgtag	5220
taacttcagtgagagttggttactcacaacaaatcctgaaaagtatttttaa         	5272
 
 
<210>	671
<211>	5315
<212>	DNA
<213>	Macaca mulatta
 
<220>	 
<223>	cDNA sequence of rhesus monkey NR3C1

<300>
<308>	XM_001097542.1
<309>	2006-06-14 
  
<400>	671
gtacttaaaggtttggatgtgtgagtagctggtaggagggaaatttggaagtaattaggg	60
attgaggaattctagcacagtatttatcaaatgttatatgtattgattctcagaaaagca	120
aacagccttgattgaaaagagttgatattcactgatggactccaaagaatcattaactcc	180
cagtagagaagaaaaccccagcagtgtgcttgctcaggagaggggaaatgtgatggactt	240
ctataaaaccctaaggggaggagctactgtgaaggtttctgcatcttcaccctcactggc	300
tgtcgcttctcagtcagactccaagcagcgaagacttttggttgattttccaaaaggctc	360
agtaagcaatgcgcagcagccagatctctccaaagcagtttcactctcaatgggactgta	420
tatgggagagacagaaacaaaagtgatgggaaatgacctgggattcccacagcagggcca	480
aatcagcctttcctcgggggaaacagacttaaagcttttggaagaaagcattgcaaacct	540
caataggtcgaccagtgttccagagaaccccaagagttcagcatccactgctgtgtctgc	600
tgcccccacaaagaaggagtttccaaaaactcactctgatggatcttcagaacagcaaaa	660
tttgaagggccatactggcaccaacggcggcaatgtgaaattgtataccgcagaccaaag	720
cacctttgacattttgcaggatttggagttttcttctgggtccccaggtaaagagacgaa	780
tgagagtccttggagatcagacctgttgatagatgaaaactgtttgctttctcctctggc	840
gggagaagacgattcattccttttggaaggaaattcgaatgaggactgtaagcctctcat	900
tttaccggacactaaacccaaaattaaggataatggagatctggttttgtcaagccccaa	960
taatgcaacactgccccaagtgaaaacagaaaaagaagatttcatcgaactctgcacccc	1020
tggggtaattaagcaagagaaactgggcacagtttactgtcaggcaagctttcctggagc	1080
aaatataattggtaataaaatgtctgccatttctgttcatggtgtgagtacctctggagg	1140
acagatgtaccactatgacatgaatacagcatccctttctcaacagcaggatcagaagcc	1200
tatttttaatgtcattccaccaattcccgttggttctgaaaattggaataggtgccaagg	1260
ttctggagacgacaacttgacttccttggggactctgaacttccctggtcgaacagtttt	1320
ttctaatggctattcaagccccagcatgagaccagatgtaagctctcctccatccagctc	1380
ctcaacagcaacaacaggaccacctccgaaactctgcctggtgtgctctgatgaagcatc	1440
aggatgtcattatggagtcttaacttgtggaagctgtaaagttttcttcaaaagagcagt	1500
ggaaggacagcacaattacctatgtgctggaaggaatgattgcatcatcgataaaattcg	1560
aagaaaaaactgcccagcatgccgctatcgaaaatgtcttcaggctggaatgaacctgga	1620
agctcgaaaaacaaagaaaaaaataaaaggaattcagcaggccactacaggagtctcaca	1680
agaaacctctgaaaatcctgctaacaaaacaatagttcctgcaacgttaccacaactcac	1740
ccctaccctggtgtcactgttggaggttattgaacctgaagtgttatatgcaggatatga	1800
tagctctgttccagactcaacttggaggatcatgaccacgctcaacatgttaggagggcg	1860
gcaagtgattgcagcagtgaaatgggcaaaagcgataccaggtttcaggaacttacacct	1920
ggatgaccaaatgaccctactgcaatactcctggatgtttcttatggcatttgccctggg	1980
gtggagatcatatagacaatcaagtgcaaacctgctgtgttttgctcctgatctgattat	2040
taatgaatacacagcagagaagtcacgcatgtacgaccaatgtaaacacatgctgtatgt	2100
ttcctctgagttacacaggcttcaggtatcttatgaagaatatctctgtatgaaaacctt	2160
actgcttctctcttcagttcctaaagacggtctgaagagccaagagctatttgatgaaat	2220
tagaatgacctacatcaaagagctaggaaaagccattgtcaagagggaaggaaactccag	2280
ccagaactggcagcggttttatcaactgacaaaactcttggattctatgcatgaagtggt	2340
tgaaaatcttcttaactattgcttccaaacatttttggataagaccatgagtattgaatt	2400
cccagagatgttagctgaaatcatcaccaatcagataccaaaatattcaaatggaaatat	2460
caaaaaacttctgtttcatcaaaagtgactgccttaataagaatggttgccttaaagaaa	2520
gtcgaattaatagcttttattgtataaactctcagtttgtcctgtagaggttttgttgtt	2580
ttattttttattgttttcgtctgttgttttgttttaaatacgcactacatgtggtttata	2640
gagggccaagacttggcaacagaagcaattgagtcatcacttttcagtgatgggagagta	2700
gacggtgaaatttcattaagttagtatatcccagaaattagaaaccttaatatgtggacg	2760
taatctccatagtcaaagaaggatggcacctaaaccaccagtgcccaaagtctgtgtgat	2820
gaactttctgctcatactttttcacagttggctggatgaaattttctagactttctgttg	2880
gtgtatccccccctgtatagttaagatagcatttttgatttatgcatggaaacctgaaaa	2940
aagtttacaagtgtatatcagaaaagggaagttgtgccttttatagctattactgtctgg	3000
ttttaacaatttcctttatatttagtgaactacgcttgctcattttttcttacataattt	3060
tttattcaagttattgtacagctgtttaagatgggcagctagttcgtagctttcccaaat	3120
aaactctaaacattaatcttctgtgtgaaaatgggttggtgcttctaacctgatggcact	3180
tagctatcagaagaccacaaaattgactcaaatctccagtattcttgtcaaaaaaaagct	3240
cacattttgtatatatctgcttcagtggagaattatataggttgtgcaaattcaccatcc	3300
taactggtatgagcacctagtccagggacctgctgggtaaactgtggatgatggttgcaa	3360
aagactgatttaaaaatcactaccaagaggccctgtctgtacctaatgccctatttttgc	3420
aaaggctatatggcaagaaagctggtaaactatttgtctttcaggaccttttgaagtagt	3480
ttgtataacttcttaaaagttgtgattccagacaaccagctgtaacacagctgagagaat	3540
tttaatcagagcaagtaattcctctcactaaactttacccaaaaactaaatctctaatat	3600
ggcaaaaatggctagacacccattttcacattcccatctgtcaccaattggttaatcttt	3660
cctgatggtacaggaaagctcagctactgatttttgtgatttagaactgtatgtcagaca	3720
tccatgtttgtaaaactacacatccctaatgtgtgccatagagtttaacacaagtcctgt	3780
gaatttcttcactgttgaaaattattttaaacaaaatagaagctgtagtagccctttctg	3840
tgtgcaccttaccaactttctgtaaactcaaaacttaacatatttactaagccacaagaa	3900
atttgatttctattcaaggtggccaaattatttgtgtaatagaaaactgaaaatctaata	3960
ttaaaaatatggaacttctaatatatttttatatttagttatagtttcagatatatatca	4020
tattggtattcactaatctgggaagggaagggctactgcagctttacatgcaatttatta	4080
aaatgattgtaaaatagcttgtatagtgtaaaataagaatgatttttagatgagattgtt	4140
ttatcatgacatgttatatattttttgtaggggtcaaagaaatgctgatggataacctat	4200
atgatttatagtttgtacatgcattcatacaggcagcgttggtctcagaacccaaacaat	4260
ttgctctaggggaagagggagatggagactggtcctgtgtgcagtgaaggttgctgaggc	4320
tctgacccaatgagattacagaggaagttaccctctgcctcccattctgaccacccttct	4380
cattccaacagtgagtctgtcagtgcaggtttagtttactcaatctccccttgcactaaa	4440
gtatgtaaacaggagacaggaaagtggtgcttacatacttaaaggcaccatctaatagtg	4500
ggttactttcacatacaggcctcccccagcagttgaatgacaacagaagtttggcaatag	4560
tttgcatagaggtaccagcaatatgtaaatagtgcagaatctcataggttgccaataata	4620
cactaattcctttctatcctacaacaagagtttatttccaaataaaatgaggacatgttt	4680
ttgttttctttgaatgctttttgaatgttatttgttattttcagtattttggagaaatta	4740
tttaataaaaaacaatcatttgctttttgaatgctctctaaaagggaatgtaatatttta	4800
agatggtttgtaacccagctggataaatttttggtgcctaagaaaactgcttgaatattt	4860
ttatcaatgacagtgttaagtttcaaaaagagcttctacaatgtagattatcattcattt	4920
atagaacgttatgtggttaaaaccagaaagcacatctcacacattaatctgattttcgtc	4980
ccaacaatcttggcgctcaaaaaatagaactcaatgaaaaaaagattatgtgtactttgc	5040
tgtcaataataagtcaactgatattcatcaacaactataggaggcttttcattaaatggg	5100
aaaagaagctgtgcccttttagaatacatgggggaaaagaaagtcatcttaattatgttt	5160
aactagggacttaagtgctatagggtggtgctgtttgaaagcagctttatttcctatgta	5220
tgtgttatctggttatcccaacccaaactattgaagtttgtagtaacttcagtgagagtt	5280
ggttactcacaacaaatcctgaaaagtatttttaa                            	5315
 
 
<210>	672
<211>	5383
<212>	DNA
<213>	Macaca mulatta
 
<220>	 
<223>	cDNA sequence of rhesus monkey NR3C1

<300>
<308>	XM_001097640.1
<309>	2006-06-14 
  
<400>	672
ttctactcgctcgaatatttgcactccaccccggcgcgcccgagcgcgagcccgggctct	60
ggggaggccccgtcgcgcctggcttggggagggcgtgcagggcgcgtgagagtacacacg	120
cggggggctgacagcttgctacttggagactccggcaggggctagcgttatctggtggaa	180
gtgggcgtgtcggagagagaactcaacagttgatattcactgatggactccaaagaatca	240
ttaactcccagtagagaagaaaaccccagcagtgtgcttgctcaggagaggggaaatgtg	300
atggacttctataaaaccctaaggggaggagctactgtgaaggtttctgcatcttcaccc	360
tcactggctgtcgcttctcagtcagactccaagcagcgaagacttttggttgattttcca	420
aaaggctcagtaagcaatgcgcagcagccagatctctccaaagcagtttcactctcaatg	480
ggactgtatatgggagagacagaaacaaaagtgatgggaaatgacctgggattcccacag	540
cagggccaaatcagcctttcctcgggggaaacagacttaaagcttttggaagaaagcatt	600
gcaaacctcaataggtcgaccagtgttccagagaaccccaagagttcagcatccactgct	660
gtgtctgctgcccccacaaagaaggagtttccaaaaactcactctgatggatcttcagaa	720
cagcaaaatttgaagggccatactggcaccaacggcggcaatgtgaaattgtataccgca	780
gaccaaagcacctttgacattttgcaggatttggagttttcttctgggtccccaggtaaa	840
gagacgaatgagagtccttggagatcagacctgttgatagatgaaaactgtttgctttct	900
cctctggcgggagaagacgattcattccttttggaaggaaattcgaatgaggactgtaag	960
cctctcattttaccggacactaaacccaaaattaaggataatggagatctggttttgtca	1020
agccccaataatgcaacactgccccaagtgaaaacagaaaaagaagatttcatcgaactc	1080
tgcacccctggggtaattaagcaagagaaactgggcacagtttactgtcaggcaagcttt	1140
cctggagcaaatataattggtaataaaatgtctgccatttctgttcatggtgtgagtacc	1200
tctggaggacagatgtaccactatgacatgaatacagcatccctttctcaacagcaggat	1260
cagaagcctatttttaatgtcattccaccaattcccgttggttctgaaaattggaatagg	1320
tgccaaggttctggagacgacaacttgacttccttggggactctgaacttccctggtcga	1380
acagttttttctaatggctattcaagccccagcatgagaccagatgtaagctctcctcca	1440
tccagctcctcaacagcaacaacaggaccacctccgaaactctgcctggtgtgctctgat	1500
gaagcatcaggatgtcattatggagtcttaacttgtggaagctgtaaagttttcttcaaa	1560
agagcagtggaaggacagcacaattacctatgtgctggaaggaatgattgcatcatcgat	1620
aaaattcgaagaaaaaactgcccagcatgccgctatcgaaaatgtcttcaggctggaatg	1680
aacctggaagctcgaaaaacaaagaaaaaaataaaaggaattcagcaggccactacagga	1740
gtctcacaagaaacctctgaaaatcctgctaacaaaacaatagttcctgcaacgttacca	1800
caactcacccctaccctggtgtcactgttggaggttattgaacctgaagtgttatatgca	1860
ggatatgatagctctgttccagactcaacttggaggatcatgaccacgctcaacatgtta	1920
ggagggcggcaagtgattgcagcagtgaaatgggcaaaagcgataccaggtttcaggaac	1980
ttacacctggatgaccaaatgaccctactgcaatactcctggatgtttcttatggcattt	2040
gccctggggtggagatcatatagacaatcaagtgcaaacctgctgtgttttgctcctgat	2100
ctgattattaatgaatacacagcagagaagtcacgcatgtacgaccaatgtaaacacatg	2160
ctgtatgtttcctctgagttacacaggcttcaggtatcttatgaagaatatctctgtatg	2220
aaaaccttactgcttctctcttcagttcctaaagacggtctgaagagccaagagctattt	2280
gatgaaattagaatgacctacatcaaagagctaggaaaagccattgtcaagagggaagga	2340
aactccagccagaactggcagcggttttatcaactgacaaaactcttggattctatgcat	2400
gaagtggttgaaaatcttcttaactattgcttccaaacatttttggataagaccatgagt	2460
attgaattcccagagatgttagctgaaatcatcaccaatcagataccaaaatattcaaat	2520
ggaaatatcaaaaaacttctgtttcatcaaaagtgactgccttaataagaatggttgcct	2580
taaagaaagtcgaattaatagcttttattgtataaactctcagtttgtcctgtagaggtt	2640
ttgttgttttattttttattgttttcgtctgttgttttgttttaaatacgcactacatgt	2700
ggtttatagagggccaagacttggcaacagaagcaattgagtcatcacttttcagtgatg	2760
ggagagtagacggtgaaatttcattaagttagtatatcccagaaattagaaaccttaata	2820
tgtggacgtaatctccatagtcaaagaaggatggcacctaaaccaccagtgcccaaagtc	2880
tgtgtgatgaactttctgctcatactttttcacagttggctggatgaaattttctagact	2940
ttctgttggtgtatccccccctgtatagttaagatagcatttttgatttatgcatggaaa	3000
cctgaaaaaagtttacaagtgtatatcagaaaagggaagttgtgccttttatagctatta	3060
ctgtctggttttaacaatttcctttatatttagtgaactacgcttgctcattttttctta	3120
cataattttttattcaagttattgtacagctgtttaagatgggcagctagttcgtagctt	3180
tcccaaataaactctaaacattaatcttctgtgtgaaaatgggttggtgcttctaacctg	3240
atggcacttagctatcagaagaccacaaaattgactcaaatctccagtattcttgtcaaa	3300
aaaaagctcacattttgtatatatctgcttcagtggagaattatataggttgtgcaaatt	3360
caccatcctaactggtatgagcacctagtccagggacctgctgggtaaactgtggatgat	3420
ggttgcaaaagactgatttaaaaatcactaccaagaggccctgtctgtacctaatgccct	3480
atttttgcaaaggctatatggcaagaaagctggtaaactatttgtctttcaggacctttt	3540
gaagtagtttgtataacttcttaaaagttgtgattccagacaaccagctgtaacacagct	3600
gagagaattttaatcagagcaagtaattcctctcactaaactttacccaaaaactaaatc	3660
tctaatatggcaaaaatggctagacacccattttcacattcccatctgtcaccaattggt	3720
taatctttcctgatggtacaggaaagctcagctactgatttttgtgatttagaactgtat	3780
gtcagacatccatgtttgtaaaactacacatccctaatgtgtgccatagagtttaacaca	3840
agtcctgtgaatttcttcactgttgaaaattattttaaacaaaatagaagctgtagtagc	3900
cctttctgtgtgcaccttaccaactttctgtaaactcaaaacttaacatatttactaagc	3960
cacaagaaatttgatttctattcaaggtggccaaattatttgtgtaatagaaaactgaaa	4020
atctaatattaaaaatatggaacttctaatatatttttatatttagttatagtttcagat	4080
atatatcatattggtattcactaatctgggaagggaagggctactgcagctttacatgca	4140
atttattaaaatgattgtaaaatagcttgtatagtgtaaaataagaatgatttttagatg	4200
agattgttttatcatgacatgttatatattttttgtaggggtcaaagaaatgctgatgga	4260
taacctatatgatttatagtttgtacatgcattcatacaggcagcgttggtctcagaacc	4320
caaacaatttgctctaggggaagagggagatggagactggtcctgtgtgcagtgaaggtt	4380
gctgaggctctgacccaatgagattacagaggaagttaccctctgcctcccattctgacc	4440
acccttctcattccaacagtgagtctgtcagtgcaggtttagtttactcaatctcccctt	4500
gcactaaagtatgtaaacaggagacaggaaagtggtgcttacatacttaaaggcaccatc	4560
taatagtgggttactttcacatacaggcctcccccagcagttgaatgacaacagaagttt	4620
ggcaatagtttgcatagaggtaccagcaatatgtaaatagtgcagaatctcataggttgc	4680
caataatacactaattcctttctatcctacaacaagagtttatttccaaataaaatgagg	4740
acatgtttttgttttctttgaatgctttttgaatgttatttgttattttcagtattttgg	4800
agaaattatttaataaaaaacaatcatttgctttttgaatgctctctaaaagggaatgta	4860
atattttaagatggtttgtaacccagctggataaatttttggtgcctaagaaaactgctt	4920
gaatatttttatcaatgacagtgttaagtttcaaaaagagcttctacaatgtagattatc	4980
attcatttatagaacgttatgtggttaaaaccagaaagcacatctcacacattaatctga	5040
ttttcgtcccaacaatcttggcgctcaaaaaatagaactcaatgaaaaaaagattatgtg	5100
tactttgctgtcaataataagtcaactgatattcatcaacaactataggaggcttttcat	5160
taaatgggaaaagaagctgtgcccttttagaatacatgggggaaaagaaagtcatcttaa	5220
ttatgtttaactagggacttaagtgctatagggtggtgctgtttgaaagcagctttattt	5280
cctatgtatgtgttatctggttatcccaacccaaactattgaagtttgtagtaacttcag	5340
tgagagttggttactcacaacaaatcctgaaaagtatttttaa                   	5383
 
 
<210>	673
<211>	5227
<212>	DNA
<213>	Macaca mulatta
 
<220>	 
<223>	cDNA sequence of rhesus monkey NR3C1

<300>
<308>	XM_001097749.1
<309>	2006-06-14 
  
<400>	673
ccattttgcgagctcgtgtctgtgacgggagcccgacggctcctctgtcagagttgatat	60
tcactgatggactccaaagaatcattaactcccagtagagaagaaaaccccagcagtgtg	120
cttgctcaggagaggggaaatgtgatggacttctataaaaccctaaggggaggagctact	180
gtgaaggtttctgcatcttcaccctcactggctgtcgcttctcagtcagactccaagcag	240
cgaagacttttggttgattttccaaaaggctcagtaagcaatgcgcagcagccagatctc	300
tccaaagcagtttcactctcaatgggactgtatatgggagagacagaaacaaaagtgatg	360
ggaaatgacctgggattcccacagcagggccaaatcagcctttcctcgggggaaacagac	420
ttaaagcttttggaagaaagcattgcaaacctcaataggtcgaccagtgttccagagaac	480
cccaagagttcagcatccactgctgtgtctgctgcccccacaaagaaggagtttccaaaa	540
actcactctgatggatcttcagaacagcaaaatttgaagggccatactggcaccaacggc	600
ggcaatgtgaaattgtataccgcagaccaaagcacctttgacattttgcaggatttggag	660
ttttcttctgggtccccaggtaaagagacgaatgagagtccttggagatcagacctgttg	720
atagatgaaaactgtttgctttctcctctggcgggagaagacgattcattccttttggaa	780
ggaaattcgaatgaggactgtaagcctctcattttaccggacactaaacccaaaattaag	840
gataatggagatctggttttgtcaagccccaataatgcaacactgccccaagtgaaaaca	900
gaaaaagaagatttcatcgaactctgcacccctggggtaattaagcaagagaaactgggc	960
acagtttactgtcaggcaagctttcctggagcaaatataattggtaataaaatgtctgcc	1020
atttctgttcatggtgtgagtacctctggaggacagatgtaccactatgacatgaataca	1080
gcatccctttctcaacagcaggatcagaagcctatttttaatgtcattccaccaattccc	1140
gttggttctgaaaattggaataggtgccaaggttctggagacgacaacttgacttccttg	1200
gggactctgaacttccctggtcgaacagttttttctaatggctattcaagccccagcatg	1260
agaccagatgtaagctctcctccatccagctcctcaacagcaacaacaggaccacctccg	1320
aaactctgcctggtgtgctctgatgaagcatcaggatgtcattatggagtcttaacttgt	1380
ggaagctgtaaagttttcttcaaaagagcagtggaaggacagcacaattacctatgtgct	1440
ggaaggaatgattgcatcatcgataaaattcgaagaaaaaactgcccagcatgccgctat	1500
cgaaaatgtcttcaggctggaatgaacctggaagctcgaaaaacaaagaaaaaaataaaa	1560
ggaattcagcaggccactacaggagtctcacaagaaacctctgaaaatcctgctaacaaa	1620
acaatagttcctgcaacgttaccacaactcacccctaccctggtgtcactgttggaggtt	1680
attgaacctgaagtgttatatgcaggatatgatagctctgttccagactcaacttggagg	1740
atcatgaccacgctcaacatgttaggagggcggcaagtgattgcagcagtgaaatgggca	1800
aaagcgataccaggtttcaggaacttacacctggatgaccaaatgaccctactgcaatac	1860
tcctggatgtttcttatggcatttgccctggggtggagatcatatagacaatcaagtgca	1920
aacctgctgtgttttgctcctgatctgattattaatgaatacacagcagagaagtcacgc	1980
atgtacgaccaatgtaaacacatgctgtatgtttcctctgagttacacaggcttcaggta	2040
tcttatgaagaatatctctgtatgaaaaccttactgcttctctcttcagttcctaaagac	2100
ggtctgaagagccaagagctatttgatgaaattagaatgacctacatcaaagagctagga	2160
aaagccattgtcaagagggaaggaaactccagccagaactggcagcggttttatcaactg	2220
acaaaactcttggattctatgcatgaagtggttgaaaatcttcttaactattgcttccaa	2280
acatttttggataagaccatgagtattgaattcccagagatgttagctgaaatcatcacc	2340
aatcagataccaaaatattcaaatggaaatatcaaaaaacttctgtttcatcaaaagtga	2400
ctgccttaataagaatggttgccttaaagaaagtcgaattaatagcttttattgtataaa	2460
ctctcagtttgtcctgtagaggttttgttgttttattttttattgttttcgtctgttgtt	2520
ttgttttaaatacgcactacatgtggtttatagagggccaagacttggcaacagaagcaa	2580
ttgagtcatcacttttcagtgatgggagagtagacggtgaaatttcattaagttagtata	2640
tcccagaaattagaaaccttaatatgtggacgtaatctccatagtcaaagaaggatggca	2700
cctaaaccaccagtgcccaaagtctgtgtgatgaactttctgctcatactttttcacagt	2760
tggctggatgaaattttctagactttctgttggtgtatccccccctgtatagttaagata	2820
gcatttttgatttatgcatggaaacctgaaaaaagtttacaagtgtatatcagaaaaggg	2880
aagttgtgccttttatagctattactgtctggttttaacaatttcctttatatttagtga	2940
actacgcttgctcattttttcttacataattttttattcaagttattgtacagctgttta	3000
agatgggcagctagttcgtagctttcccaaataaactctaaacattaatcttctgtgtga	3060
aaatgggttggtgcttctaacctgatggcacttagctatcagaagaccacaaaattgact	3120
caaatctccagtattcttgtcaaaaaaaagctcacattttgtatatatctgcttcagtgg	3180
agaattatataggttgtgcaaattcaccatcctaactggtatgagcacctagtccaggga	3240
cctgctgggtaaactgtggatgatggttgcaaaagactgatttaaaaatcactaccaaga	3300
ggccctgtctgtacctaatgccctatttttgcaaaggctatatggcaagaaagctggtaa	3360
actatttgtctttcaggaccttttgaagtagtttgtataacttcttaaaagttgtgattc	3420
cagacaaccagctgtaacacagctgagagaattttaatcagagcaagtaattcctctcac	3480
taaactttacccaaaaactaaatctctaatatggcaaaaatggctagacacccattttca	3540
cattcccatctgtcaccaattggttaatctttcctgatggtacaggaaagctcagctact	3600
gatttttgtgatttagaactgtatgtcagacatccatgtttgtaaaactacacatcccta	3660
atgtgtgccatagagtttaacacaagtcctgtgaatttcttcactgttgaaaattatttt	3720
aaacaaaatagaagctgtagtagccctttctgtgtgcaccttaccaactttctgtaaact	3780
caaaacttaacatatttactaagccacaagaaatttgatttctattcaaggtggccaaat	3840
tatttgtgtaatagaaaactgaaaatctaatattaaaaatatggaacttctaatatattt	3900
ttatatttagttatagtttcagatatatatcatattggtattcactaatctgggaaggga	3960
agggctactgcagctttacatgcaatttattaaaatgattgtaaaatagcttgtatagtg	4020
taaaataagaatgatttttagatgagattgttttatcatgacatgttatatattttttgt	4080
aggggtcaaagaaatgctgatggataacctatatgatttatagtttgtacatgcattcat	4140
acaggcagcgttggtctcagaacccaaacaatttgctctaggggaagagggagatggaga	4200
ctggtcctgtgtgcagtgaaggttgctgaggctctgacccaatgagattacagaggaagt	4260
taccctctgcctcccattctgaccacccttctcattccaacagtgagtctgtcagtgcag	4320
gtttagtttactcaatctccccttgcactaaagtatgtaaacaggagacaggaaagtggt	4380
gcttacatacttaaaggcaccatctaatagtgggttactttcacatacaggcctccccca	4440
gcagttgaatgacaacagaagtttggcaatagtttgcatagaggtaccagcaatatgtaa	4500
atagtgcagaatctcataggttgccaataatacactaattcctttctatcctacaacaag	4560
agtttatttccaaataaaatgaggacatgtttttgttttctttgaatgctttttgaatgt	4620
tatttgttattttcagtattttggagaaattatttaataaaaaacaatcatttgcttttt	4680
gaatgctctctaaaagggaatgtaatattttaagatggtttgtaacccagctggataaat	4740
ttttggtgcctaagaaaactgcttgaatatttttatcaatgacagtgttaagtttcaaaa	4800
agagcttctacaatgtagattatcattcatttatagaacgttatgtggttaaaaccagaa	4860
agcacatctcacacattaatctgattttcgtcccaacaatcttggcgctcaaaaaataga	4920
actcaatgaaaaaaagattatgtgtactttgctgtcaataataagtcaactgatattcat	4980
caacaactataggaggcttttcattaaatgggaaaagaagctgtgcccttttagaataca	5040
tgggggaaaagaaagtcatcttaattatgtttaactagggacttaagtgctatagggtgg	5100
tgctgtttgaaagcagctttatttcctatgtatgtgttatctggttatcccaacccaaac	5160
tattgaagtttgtagtaacttcagtgagagttggttactcacaacaaatcctgaaaagta	5220
tttttaa                                                     	5227
 
 
<210>	674
<211>	5375
<212>	DNA
<213>	Macaca mulatta
 
<220>	 
<223>	cDNA sequence of rhesus monkey NR3C1

<300>
<308>	XM_001097846.1
<309>	2006-06-14 
  
<400>	674
tgcagtttgtgtcccacagatattaacttcaataagcacttaatgagggccttccctgtg	60
cgagaatggggaggaacaaaatgcagctcctgccctcctggggctttagttgtaccttag	120
taagaggaattttcatctgcctggctcctttcctcaaagaacaaagaagactttgcttca	180
ttaaagtgtctgagaaggaagttgatattcactgatggactccaaagaatcattaactcc	240
cagtagagaagaaaaccccagcagtgtgcttgctcaggagaggggaaatgtgatggactt	300
ctataaaaccctaaggggaggagctactgtgaaggtttctgcatcttcaccctcactggc	360
tgtcgcttctcagtcagactccaagcagcgaagacttttggttgattttccaaaaggctc	420
agtaagcaatgcgcagcagccagatctctccaaagcagtttcactctcaatgggactgta	480
tatgggagagacagaaacaaaagtgatgggaaatgacctgggattcccacagcagggcca	540
aatcagcctttcctcgggggaaacagacttaaagcttttggaagaaagcattgcaaacct	600
caataggtcgaccagtgttccagagaaccccaagagttcagcatccactgctgtgtctgc	660
tgcccccacaaagaaggagtttccaaaaactcactctgatggatcttcagaacagcaaaa	720
tttgaagggccatactggcaccaacggcggcaatgtgaaattgtataccgcagaccaaag	780
cacctttgacattttgcaggatttggagttttcttctgggtccccaggtaaagagacgaa	840
tgagagtccttggagatcagacctgttgatagatgaaaactgtttgctttctcctctggc	900
gggagaagacgattcattccttttggaaggaaattcgaatgaggactgtaagcctctcat	960
tttaccggacactaaacccaaaattaaggataatggagatctggttttgtcaagccccaa	1020
taatgcaacactgccccaagtgaaaacagaaaaagaagatttcatcgaactctgcacccc	1080
tggggtaattaagcaagagaaactgggcacagtttactgtcaggcaagctttcctggagc	1140
aaatataattggtaataaaatgtctgccatttctgttcatggtgtgagtacctctggagg	1200
acagatgtaccactatgacatgaatacagcatccctttctcaacagcaggatcagaagcc	1260
tatttttaatgtcattccaccaattcccgttggttctgaaaattggaataggtgccaagg	1320
ttctggagacgacaacttgacttccttggggactctgaacttccctggtcgaacagtttt	1380
ttctaatggctattcaagccccagcatgagaccagatgtaagctctcctccatccagctc	1440
ctcaacagcaacaacaggaccacctccgaaactctgcctggtgtgctctgatgaagcatc	1500
aggatgtcattatggagtcttaacttgtggaagctgtaaagttttcttcaaaagagcagt	1560
ggaaggacagcacaattacctatgtgctggaaggaatgattgcatcatcgataaaattcg	1620
aagaaaaaactgcccagcatgccgctatcgaaaatgtcttcaggctggaatgaacctgga	1680
agctcgaaaaacaaagaaaaaaataaaaggaattcagcaggccactacaggagtctcaca	1740
agaaacctctgaaaatcctgctaacaaaacaatagttcctgcaacgttaccacaactcac	1800
ccctaccctggtgtcactgttggaggttattgaacctgaagtgttatatgcaggatatga	1860
tagctctgttccagactcaacttggaggatcatgaccacgctcaacatgttaggagggcg	1920
gcaagtgattgcagcagtgaaatgggcaaaagcgataccaggtttcaggaacttacacct	1980
ggatgaccaaatgaccctactgcaatactcctggatgtttcttatggcatttgccctggg	2040
gtggagatcatatagacaatcaagtgcaaacctgctgtgttttgctcctgatctgattat	2100
taatgaatacacagcagagaagtcacgcatgtacgaccaatgtaaacacatgctgtatgt	2160
ttcctctgagttacacaggcttcaggtatcttatgaagaatatctctgtatgaaaacctt	2220
actgcttctctcttcagttcctaaagacggtctgaagagccaagagctatttgatgaaat	2280
tagaatgacctacatcaaagagctaggaaaagccattgtcaagagggaaggaaactccag	2340
ccagaactggcagcggttttatcaactgacaaaactcttggattctatgcatgaagtggt	2400
tgaaaatcttcttaactattgcttccaaacatttttggataagaccatgagtattgaatt	2460
cccagagatgttagctgaaatcatcaccaatcagataccaaaatattcaaatggaaatat	2520
caaaaaacttctgtttcatcaaaagtgactgccttaataagaatggttgccttaaagaaa	2580
gtcgaattaatagcttttattgtataaactctcagtttgtcctgtagaggttttgttgtt	2640
ttattttttattgttttcgtctgttgttttgttttaaatacgcactacatgtggtttata	2700
gagggccaagacttggcaacagaagcaattgagtcatcacttttcagtgatgggagagta	2760
gacggtgaaatttcattaagttagtatatcccagaaattagaaaccttaatatgtggacg	2820
taatctccatagtcaaagaaggatggcacctaaaccaccagtgcccaaagtctgtgtgat	2880
gaactttctgctcatactttttcacagttggctggatgaaattttctagactttctgttg	2940
gtgtatccccccctgtatagttaagatagcatttttgatttatgcatggaaacctgaaaa	3000
aagtttacaagtgtatatcagaaaagggaagttgtgccttttatagctattactgtctgg	3060
ttttaacaatttcctttatatttagtgaactacgcttgctcattttttcttacataattt	3120
tttattcaagttattgtacagctgtttaagatgggcagctagttcgtagctttcccaaat	3180
aaactctaaacattaatcttctgtgtgaaaatgggttggtgcttctaacctgatggcact	3240
tagctatcagaagaccacaaaattgactcaaatctccagtattcttgtcaaaaaaaagct	3300
cacattttgtatatatctgcttcagtggagaattatataggttgtgcaaattcaccatcc	3360
taactggtatgagcacctagtccagggacctgctgggtaaactgtggatgatggttgcaa	3420
aagactgatttaaaaatcactaccaagaggccctgtctgtacctaatgccctatttttgc	3480
aaaggctatatggcaagaaagctggtaaactatttgtctttcaggaccttttgaagtagt	3540
ttgtataacttcttaaaagttgtgattccagacaaccagctgtaacacagctgagagaat	3600
tttaatcagagcaagtaattcctctcactaaactttacccaaaaactaaatctctaatat	3660
ggcaaaaatggctagacacccattttcacattcccatctgtcaccaattggttaatcttt	3720
cctgatggtacaggaaagctcagctactgatttttgtgatttagaactgtatgtcagaca	3780
tccatgtttgtaaaactacacatccctaatgtgtgccatagagtttaacacaagtcctgt	3840
gaatttcttcactgttgaaaattattttaaacaaaatagaagctgtagtagccctttctg	3900
tgtgcaccttaccaactttctgtaaactcaaaacttaacatatttactaagccacaagaa	3960
atttgatttctattcaaggtggccaaattatttgtgtaatagaaaactgaaaatctaata	4020
ttaaaaatatggaacttctaatatatttttatatttagttatagtttcagatatatatca	4080
tattggtattcactaatctgggaagggaagggctactgcagctttacatgcaatttatta	4140
aaatgattgtaaaatagcttgtatagtgtaaaataagaatgatttttagatgagattgtt	4200
ttatcatgacatgttatatattttttgtaggggtcaaagaaatgctgatggataacctat	4260
atgatttatagtttgtacatgcattcatacaggcagcgttggtctcagaacccaaacaat	4320
ttgctctaggggaagagggagatggagactggtcctgtgtgcagtgaaggttgctgaggc	4380
tctgacccaatgagattacagaggaagttaccctctgcctcccattctgaccacccttct	4440
cattccaacagtgagtctgtcagtgcaggtttagtttactcaatctccccttgcactaaa	4500
gtatgtaaacaggagacaggaaagtggtgcttacatacttaaaggcaccatctaatagtg	4560
ggttactttcacatacaggcctcccccagcagttgaatgacaacagaagtttggcaatag	4620
tttgcatagaggtaccagcaatatgtaaatagtgcagaatctcataggttgccaataata	4680
cactaattcctttctatcctacaacaagagtttatttccaaataaaatgaggacatgttt	4740
ttgttttctttgaatgctttttgaatgttatttgttattttcagtattttggagaaatta	4800
tttaataaaaaacaatcatttgctttttgaatgctctctaaaagggaatgtaatatttta	4860
agatggtttgtaacccagctggataaatttttggtgcctaagaaaactgcttgaatattt	4920
ttatcaatgacagtgttaagtttcaaaaagagcttctacaatgtagattatcattcattt	4980
atagaacgttatgtggttaaaaccagaaagcacatctcacacattaatctgattttcgtc	5040
ccaacaatcttggcgctcaaaaaatagaactcaatgaaaaaaagattatgtgtactttgc	5100
tgtcaataataagtcaactgatattcatcaacaactataggaggcttttcattaaatggg	5160
aaaagaagctgtgcccttttagaatacatgggggaaaagaaagtcatcttaattatgttt	5220
aactagggacttaagtgctatagggtggtgctgtttgaaagcagctttatttcctatgta	5280
tgtgttatctggttatcccaacccaaactattgaagtttgtagtaacttcagtgagagtt	5340
ggttactcacaacaaatcctgaaaagtatttttaa                            	5375
 
 
<210>	675
<211>	5315
<212>	DNA
<213>	Macaca mulatta
 
<220>	 
<223>	cDNA sequence of rhesus monkey NR3C1

<300>
<308>	XM_001097942.1
<309>	2006-06-14 
  
<400>	675
gtacttaaaggtttggatgtgtgagtagctggtaggagggaaatttggaagtaattaggg	60
attgaggaattctagcacagtatttatcaaatgttatatgtattgattctcagaaaagca	120
aacagccttgattgaaaagagttgatattcactgatggactccaaagaatcattaactcc	180
cagtagagaagaaaaccccagcagtgtgcttgctcaggagaggggaaatgtgatggactt	240
ctataaaaccctaaggggaggagctactgtgaaggtttctgcatcttcaccctcactggc	300
tgtcgcttctcagtcagactccaagcagcgaagacttttggttgattttccaaaaggctc	360
agtaagcaatgcgcagcagccagatctctccaaagcagtttcactctcaatgggactgta	420
tatgggagagacagaaacaaaagtgatgggaaatgacctgggattcccacagcagggcca	480
aatcagcctttcctcgggggaaacagacttaaagcttttggaagaaagcattgcaaacct	540
caataggtcgaccagtgttccagagaaccccaagagttcagcatccactgctgtgtctgc	600
tgcccccacaaagaaggagtttccaaaaactcactctgatggatcttcagaacagcaaaa	660
tttgaagggccatactggcaccaacggcggcaatgtgaaattgtataccgcagaccaaag	720
cacctttgacattttgcaggatttggagttttcttctgggtccccaggtaaagagacgaa	780
tgagagtccttggagatcagacctgttgatagatgaaaactgtttgctttctcctctggc	840
gggagaagacgattcattccttttggaaggaaattcgaatgaggactgtaagcctctcat	900
tttaccggacactaaacccaaaattaaggataatggagatctggttttgtcaagccccaa	960
taatgcaacactgccccaagtgaaaacagaaaaagaagatttcatcgaactctgcacccc	1020
tggggtaattaagcaagagaaactgggcacagtttactgtcaggcaagctttcctggagc	1080
aaatataattggtaataaaatgtctgccatttctgttcatggtgtgagtacctctggagg	1140
acagatgtaccactatgacatgaatacagcatccctttctcaacagcaggatcagaagcc	1200
tatttttaatgtcattccaccaattcccgttggttctgaaaattggaataggtgccaagg	1260
ttctggagacgacaacttgacttccttggggactctgaacttccctggtcgaacagtttt	1320
ttctaatggctattcaagccccagcatgagaccagatgtaagctctcctccatccagctc	1380
ctcaacagcaacaacaggaccacctccgaaactctgcctggtgtgctctgatgaagcatc	1440
aggatgtcattatggagtcttaacttgtggaagctgtaaagttttcttcaaaagagcagt	1500
ggaaggacagcacaattacctatgtgctggaaggaatgattgcatcatcgataaaattcg	1560
aagaaaaaactgcccagcatgccgctatcgaaaatgtcttcaggctggaatgaacctgga	1620
agctcgaaaaacaaagaaaaaaataaaaggaattcagcaggccactacaggagtctcaca	1680
agaaacctctgaaaatcctgctaacaaaacaatagttcctgcaacgttaccacaactcac	1740
ccctaccctggtgtcactgttggaggttattgaacctgaagtgttatatgcaggatatga	1800
tagctctgttccagactcaacttggaggatcatgaccacgctcaacatgttaggagggcg	1860
gcaagtgattgcagcagtgaaatgggcaaaagcgataccaggtttcaggaacttacacct	1920
ggatgaccaaatgaccctactgcaatactcctggatgtttcttatggcatttgccctggg	1980
gtggagatcatatagacaatcaagtgcaaacctgctgtgttttgctcctgatctgattat	2040
taatgaatacacagcagagaagtcacgcatgtacgaccaatgtaaacacatgctgtatgt	2100
ttcctctgagttacacaggcttcaggtatcttatgaagaatatctctgtatgaaaacctt	2160
actgcttctctcttcagttcctaaagacggtctgaagagccaagagctatttgatgaaat	2220
tagaatgacctacatcaaagagctaggaaaagccattgtcaagagggaaggaaactccag	2280
ccagaactggcagcggttttatcaactgacaaaactcttggattctatgcatgaagtggt	2340
tgaaaatcttcttaactattgcttccaaacatttttggataagaccatgagtattgaatt	2400
cccagagatgttagctgaaatcatcaccaatcagataccaaaatattcaaatggaaatat	2460
caaaaaacttctgtttcatcaaaagtgactgccttaataagaatggttgccttaaagaaa	2520
gtcgaattaatagcttttattgtataaactctcagtttgtcctgtagaggttttgttgtt	2580
ttattttttattgttttcgtctgttgttttgttttaaatacgcactacatgtggtttata	2640
gagggccaagacttggcaacagaagcaattgagtcatcacttttcagtgatgggagagta	2700
gacggtgaaatttcattaagttagtatatcccagaaattagaaaccttaatatgtggacg	2760
taatctccatagtcaaagaaggatggcacctaaaccaccagtgcccaaagtctgtgtgat	2820
gaactttctgctcatactttttcacagttggctggatgaaattttctagactttctgttg	2880
gtgtatccccccctgtatagttaagatagcatttttgatttatgcatggaaacctgaaaa	2940
aagtttacaagtgtatatcagaaaagggaagttgtgccttttatagctattactgtctgg	3000
ttttaacaatttcctttatatttagtgaactacgcttgctcattttttcttacataattt	3060
tttattcaagttattgtacagctgtttaagatgggcagctagttcgtagctttcccaaat	3120
aaactctaaacattaatcttctgtgtgaaaatgggttggtgcttctaacctgatggcact	3180
tagctatcagaagaccacaaaattgactcaaatctccagtattcttgtcaaaaaaaagct	3240
cacattttgtatatatctgcttcagtggagaattatataggttgtgcaaattcaccatcc	3300
taactggtatgagcacctagtccagggacctgctgggtaaactgtggatgatggttgcaa	3360
aagactgatttaaaaatcactaccaagaggccctgtctgtacctaatgccctatttttgc	3420
aaaggctatatggcaagaaagctggtaaactatttgtctttcaggaccttttgaagtagt	3480
ttgtataacttcttaaaagttgtgattccagacaaccagctgtaacacagctgagagaat	3540
tttaatcagagcaagtaattcctctcactaaactttacccaaaaactaaatctctaatat	3600
ggcaaaaatggctagacacccattttcacattcccatctgtcaccaattggttaatcttt	3660
cctgatggtacaggaaagctcagctactgatttttgtgatttagaactgtatgtcagaca	3720
tccatgtttgtaaaactacacatccctaatgtgtgccatagagtttaacacaagtcctgt	3780
gaatttcttcactgttgaaaattattttaaacaaaatagaagctgtagtagccctttctg	3840
tgtgcaccttaccaactttctgtaaactcaaaacttaacatatttactaagccacaagaa	3900
atttgatttctattcaaggtggccaaattatttgtgtaatagaaaactgaaaatctaata	3960
ttaaaaatatggaacttctaatatatttttatatttagttatagtttcagatatatatca	4020
tattggtattcactaatctgggaagggaagggctactgcagctttacatgcaatttatta	4080
aaatgattgtaaaatagcttgtatagtgtaaaataagaatgatttttagatgagattgtt	4140
ttatcatgacatgttatatattttttgtaggggtcaaagaaatgctgatggataacctat	4200
atgatttatagtttgtacatgcattcatacaggcagcgttggtctcagaacccaaacaat	4260
ttgctctaggggaagagggagatggagactggtcctgtgtgcagtgaaggttgctgaggc	4320
tctgacccaatgagattacagaggaagttaccctctgcctcccattctgaccacccttct	4380
cattccaacagtgagtctgtcagtgcaggtttagtttactcaatctccccttgcactaaa	4440
gtatgtaaacaggagacaggaaagtggtgcttacatacttaaaggcaccatctaatagtg	4500
ggttactttcacatacaggcctcccccagcagttgaatgacaacagaagtttggcaatag	4560
tttgcatagaggtaccagcaatatgtaaatagtgcagaatctcataggttgccaataata	4620
cactaattcctttctatcctacaacaagagtttatttccaaataaaatgaggacatgttt	4680
ttgttttctttgaatgctttttgaatgttatttgttattttcagtattttggagaaatta	4740
tttaataaaaaacaatcatttgctttttgaatgctctctaaaagggaatgtaatatttta	4800
agatggtttgtaacccagctggataaatttttggtgcctaagaaaactgcttgaatattt	4860
ttatcaatgacagtgttaagtttcaaaaagagcttctacaatgtagattatcattcattt	4920
atagaacgttatgtggttaaaaccagaaagcacatctcacacattaatctgattttcgtc	4980
ccaacaatcttggcgctcaaaaaatagaactcaatgaaaaaaagattatgtgtactttgc	5040
tgtcaataataagtcaactgatattcatcaacaactataggaggcttttcattaaatggg	5100
aaaagaagctgtgcccttttagaatacatgggggaaaagaaagtcatcttaattatgttt	5160
aactagggacttaagtgctatagggtggtgctgtttgaaagcagctttatttcctatgta	5220
tgtgttatctggttatcccaacccaaactattgaagtttgtagtaacttcagtgagagtt	5280
ggttactcacaacaaatcctgaaaagtatttttaa                            	5315
 
 
<210>	676
<211>	618
<212>	DNA
<213>	Macaca fascicularis
 
<220>	 
<223>	cDNA (EST) sequence of macaca fascicularis NR3C1

<300>
<308>	BB878843.1
<309>	2008-11-18

<400>	676
agttaggcgcgttttcttttttagtttctcctatttggcattgctgtaaatggctaacta	60
acatttactgccaatttggtacaaatgtgtggtttggtaataccagaacagcaaatttaa	120
atgaaaaaataaaagttagacatttccacacaaggttttacagtctgacatttcactgcg	180
taggtaaaaagacattttttttttaactacagattattattcagcatgaataaaaaacta	240
caacttttatttttaaacaggagtcactggttttaatttttacacattttaaaattactg	300
tgataaaaaataatgaaaaagctttttaataatgccatacacagtataatatagatttgt	360
ccccattatatagcatttaatatacaaaatagaatattgacacacttgaatctatatgta	420
gttaagcaagttatttgaggagggtattttcatacagcctttcatcaaaaaataaaatcc	480
tttcaaacattttctaaagagaagcaaatcctttcctgaaaacctggtcactaatcctgg	540
gtggaccaggttgcttgaaaatagtctgggatattatgaaactccacccaaagggcttaa	600
agtgtcctccttacactt                                          	618
 
 
<210>	677
<211>	20
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	primer for psiCHECK insert
 
<400>	677
tgtccgcaac tacaacgcct 	20


<210> 678 
<211> 6123 
<212> DNA 
<213> Macaca fascicularis 
  
<220>   
<223> Genomic sequence of macaca fascicularis NR3C1 
  
<220>   
<221> modified_base 
<222> 257, 258, 559, 560, 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 1099, 1100, 1101, 1102, 1103, 1104, 1105, 1106, 1107, 1108, 1109, 1110, 1111, 1112, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1120, 1121, 1122, 1123, 1124, 1125, 1126, 1127, 1128, 1129, 1130, 1131, 1132, 1133, 1134, 1135, 1136, 1137, 1138, 1139, 1140, 1141, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1165, 1166, 1167, 1168, 1169, 1170, 1171, 1172, 1173, 1174, 1175, 1176, 1177, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1187, 1188, 1189, 1190, 1191, 1192, 1193, 1194, 1195, 1196, 1197, 1198, 1199, 1200, 1201, 1202, 1203, 1204, 1205, 1206, 1207, 1208, 1209, 1210, 1211, 1212, 1213, 1214, 1215, 1216, 1217, 1218, 1219, 1220, 1221, 1222, 1223, 1224, 1225, 1226, 1227, 1228, 1229, 1230, 1231, 1232, 1233, 1234, 1235, 1236, 1237, 1238, 1239, 1240, 1241, 1242, 1243, 1244, 1245, 1246, 1247, 1248, 1249, 1250, 1251, 1252, 1253, 1254, 1255, 1256, 1257, 1258, 1259, 1260, 1261, 1262, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1270, 1271, 1272, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1286, 1287, 1288, 1289, 1290, 1291, 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301, 1302, 1303, 1304, 1305, 1306, 1307, 1308, 1309, 1310, 1311, 1312, 1313, 1314, 1315, 1316, 1317, 1318, 1319, 1320, 1321, 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394, 1395, 1396, 1397, 1398, 1399, 1400, 1401, 1402, 1403, 1404, 1405, 1406, 1407, 1408, 1409, 1410, 1411, 1412, 1413, 1414, 1415, 1416, 1417, 1418, 1419, 1420, 1421, 1422, 1423, 1424, 1425, 1426, 1427, 1428, 1429, 1430, 1431, 1432, 1433, 1434, 1435, 1436, 1437, 1438, 1439, 1440, 1441, 1442, 1443, 1444, 1445, 1446, 1447, 1448, 1449, 1450, 1451, 1452, 1453, 1454, 1455, 1456, 1457, 1458, 1459, 1460, 1461, 1462, 1463, 1464, 1465, 1466, 1467, 1468, 1469, 1470, 1471, 1472, 1473, 1474, 1475, 1476, 1477, 1478, 1479, 1480, 1481, 1482, 1483, 1484, 1485, 1486, 1487, 1488, 1489, 1490, 1491, 2696, 2697, 2698, 2699, 2700, 2701, 2702, 2703, 2704, 2705, 2706, 2707, 2708, 2709, 2710, 2711, 2712, 2713, 2714, 2715, 2716, 2717, 2718, 2719, 2720, 2721, 2722, 2723, 2724, 2725, 2726, 2727, 2728, 2729, 2730, 2731, 2732, 2733, 2734, 2735, 2736, 2737, 2738, 2739, 2740, 2741, 2742, 2743, 2744, 2745, 2746, 2747, 2748, 2749, 2750, 2751, 2752, 2753, 2754, 2755, 2756, 2757, 2758, 2759, 2760, 2761, 2762, 2763, 2764, 2765, 2766, 2767, 2768, 2769, 2770, 2771, 2772, 2773, 2774, 2775, 2776, 2777, 2778, 2779, 2780, 2781, 2782, 2783, 2784, 2785, 2786, 2787, 2788, 2789, 2790, 2791, 2792, 2793, 2794, 2795, 2796, 2797, 2798, 2799, 2800, 2801, 2802, 2803, 2804, 2805, 2806, 2807, 2808, 2809, 2810, 2811, 2812, 2813, 2814, 2815, 2816, 2817, 2818, 2819, 2820, 2821, 2822, 2823, 2824, 2825, 2826, 2827, 2828, 2829, 2830, 2831, 2832, 2833, 2834, 2835, 2836, 2837, 2838, 2839, 2840, 2841, 2842, 2843, 2844, 2845, 2846, 2847, 2848, 2849, 2850, 2851, 2852, 2853, 2854, 2855, 2856, 2857, 2858, 2859, 2860, 2861, 2862, 2863, 2864, 2865, 2866, 2867, 2868, 2869, 3061, 3062, 3063, 3064, 3065, 3066, 3067, 3068, 3069, 3070, 3071, 3072, 3073, 3074, 3075, 3076, 3077, 3078, 3079, 3080, 3081, 3082, 3083, 3084, 3085, 3086, 3087, 3088, 3089, 3090, 3091, 3092, 3093, 3094, 3095, 3096, 3097, 3098, 3099, 3100, 3101, 3102, 3103, 3104, 3105, 3106, 3107, 3108, 3109, 3110, 3111, 3112, 3113, 3114, 3115, 3116, 3117, 3118, 3119, 3120, 3121, 3122, 3123, 3124, 3125, 3126, 3127, 3128, 3129, 3130, 3131, 3132, 3133, 3134, 3135, 3136, 3137, 3138, 3139, 3140, 3141, 3142, 3143, 3144, 3145, 3146, 3147, 3148, 3149, 3150, 3151, 3152, 3153, 3154, 3155, 3156, 3157, 3158, 3159, 3160, 3161, 3162, 3163, 3164, 3165, 3166, 3310, 3311, 3312, 3313, 3314, 3315, 3316, 3317, 3318, 3319, 3320, 3321, 3322, 3323, 3324, 3325, 3326, 3327, 3328, 3329, 3330, 3331, 3332, 3333, 3334, 3335, 3336, 3488, 3492, 3495, 3496, 3497, 3498, 3499, 3500, 3501, 3502, 3503, 3504, 3505, 3506, 3507, 3508, 3509, 3510, 3511, 3512, 3513, 3514, 3515, 3516, 3517, 3518, 3519, 3520, 3521, 3522, 3523, 3524, 3525, 3526, 3527, 3528, 3529, 3530, 3531, 3532, 3533, 3534, 3535, 3536, 3537, 3538, 3539, 3540, 3541, 3542, 3543, 3544, 3545, 3546, 3547, 3548, 3549, 3550, 3551, 3552, 3553, 3554, 3555, 3556, 3557, 3558, 3559, 3560, 3561, 3562, 3563, 3564, 3565, 3566, 3567, 3568, 3569, 3570, 3571, 3572, 3573, 3574, 3575, 3576, 3577, 3578, 3579, 3580, 3581, 3582, 3583, 3584, 3585, 3586, 3587, 3588, 3589, 3590, 3591, 3592, 3593, 3594, 3595, 3596, 3597, 3598, 3599, 3600, 3601, 3602, 3603, 3604, 3605, 3606, 3607, 3608, 3609, 3610, 3611, 3612, 3613, 3614, 3615, 3616, 3617, 3618, 3619, 3620, 3621, 3622, 3623, 3624, 3625, 3626, 3627, 3628, 3629, 3630, 3631, 3632, 3633, 3634, 3635, 3636, 3637, 3638, 3639, 3640, 3641, 3642, 3643, 3644, 3645, 3646, 3647, 3648, 3649, 3650, 3651, 3652, 3653, 3654, 3655, 3656, 3657, 3658, 3659, 3660, 3661, 3662, 3663, 3664, 3665, 3666, 3667, 3668, 3669, 3670, 3671, 3672, 3673, 3674, 3675, 3676, 3677, 3678, 3679, 3680, 3681, 3682, 3683, 3684, 3685, 3686, 3687, 3688, 3689, 3690, 3691, 3692, 3693, 3694, 3695, 3696, 3697, 3698, 3699, 3700, 3701, 3702, 3703, 3704, 3705, 3706, 3707, 3708, 3709, 3710, 3711, 3712, 3713, 3714, 3715, 3716, 3717, 3718, 3719, 3720, 3721, 3722, 3723, 3724, 3725, 3726, 3727, 3728, 3729, 3730, 3731, 3732, 3733, 3734, 3735, 3736, 3737, 3738, 3739, 3740, 3741, 3742, 3743, 3744, 3745, 3746, 3747, 3748, 3749, 3750, 3751, 3752, 3753, 3754, 3755, 3756, 3757, 3758, 3759, 3760, 3761, 3765, 3770, 3772, 3773, 3829, 3830, 3831, 3832, 3833, 3834, 3835, 3836, 3837, 3838, 3839, 3840, 3841, 3842, 3843, 3844, 3845, 3846, 3847, 3848, 3849, 3850, 3851, 3852, 3853, 3854, 3855, 3856, 3857, 3858, 3859, 3860, 3861, 3862, 3863, 3864, 3865, 3866, 3867, 3868, 3869, 3870, 3871, 3872, 3873, 3874, 3875, 3876, 3877, 3878, 3879, 3880, 3881, 3882, 3883, 3884, 3885, 3886, 3887, 3888, 3889, 3890, 3891, 3892, 3893, 3894, 3895, 3896, 3897, 3898, 3899, 3900, 3901, 3902, 3903, 3904, 3905, 3906, 3907, 3908, 3909, 3910, 3911, 3912, 3913, 3914, 3915, 3916, 3917, 3918, 3919, 3920, 3921, 3922, 3923, 3924, 3925, 3926, 3927, 3928, 3929, 3930, 3931, 3932, 3933, 3934, 3935, 3936, 3937, 3938, 3939, 3940, 3941, 3942, 3943, 3944, 3945, 3946, 3947, 3948, 3949, 3950, 3951, 3952, 3953, 3954, 3955, 3956, 3957, 3958, 3959, 3960, 3961, 3962, 3963, 3964, 3965, 3966, 3967, 3968, 3969, 3970, 3971, 3972, 3973, 3974, 3975, 3976, 3977, 3978, 3979, 3980, 3981, 3982, 3983, 3984, 3985, 3986, 3987, 3988, 3989, 3990, 3991, 3992, 3993, 3994, 3995, 3996, 3997, 3998, 3999, 4000, 4001, 4002, 4003, 4004, 4005, 4006, 4007, 4008, 4009, 4010, 4011, 4012, 4013, 4014, 4015, 4016, 4017, 4018, 4019, 4020, 4021, 4022, 4023, 4024, 4025, 4026, 4027, 4028, 4029, 4030, 4031, 4032, 4033, 4034, 4035, 4036, 4037, 4038, 4039, 4040, 4041, 4042, 4043, 4114, 4115, 4116, 4273, 4279, 4285, 4330, 4525, 4526, 4527, 4528, 4529, 4530, 4531, 4532, 4533, 4534, 4535, 4536, 4537, 4538, 4539, 4540, 4541, 4542, 4543, 4544, 4545, 4546, 4547, 4548, 4549, 4550, 4551, 4552, 4553, 4554, 4555, 4556, 4557, 4558, 4559, 4560, 4561, 4562, 4563, 4564, 4565, 4566, 4567, 4568, 4569, 4570, 4571, 4572, 4573, 4574, 4575, 4576, 4577, 4578, 4579, 4580, 4581, 4582, 4583, 4584, 4585, 4586, 4587, 4588, 4589, 4590, 4591, 4592, 4593, 4594, 4595, 4596, 4597, 4598, 4599, 4600, 4601, 4602, 4603, 4604, 4605, 4606, 4607, 4608, 4609, 4610, 4611, 4612, 4613, 4614, 4615, 4616, 4617, 4618, 4619, 4620, 4621, 4622, 4623, 4624, 4625, 4626, 4627, 4628, 4629, 4630, 4631, 4632, 4633, 4634, 4635, 4636, 4637, 4638, 4639, 4640, 4641, 4642, 4643, 4644, 4645, 4646, 4647, 4648, 4649, 4650, 4651, 4652, 4653, 4654, 4655, 4656, 4657, 4658, 4659, 4660, 4661, 4662, 4663, 4664, 4665, 4666, 4667, 4668, 4669, 4670, 4671, 4672, 4673, 4674, 4675, 4676, 4677, 4678, 4679, 4680, 4681, 4682, 4683, 4684, 4685, 4686, 4687, 4688, 4689, 4690, 4691, 4692, 4693, 4694, 4695, 4696, 4697, 4698, 4699, 4700, 4701, 4702, 4703, 4704, 4705, 4706, 4707, 4708, 4709, 4710, 4711, 4712, 4713, 4714, 4715, 4716, 4717, 4718, 4719, 4720, 4721, 4722, 4723, 4724, 4725, 4726, 4727, 4728, 4729, 4730, 4731, 4732, 4733, 4734, 4735, 4736, 4737, 4738, 4739, 4740, 4741, 4742, 4743, 4744, 4745, 4746, 4747, 4748, 4773, 4840, 5017, 5549, 5550, 5551, 5552, 5553, 5554, 5555, 5556, 5557, 5558, 5559, 5560, 5561, 5562, 5563, 5564, 5565, 5566, 5567, 5568, 5569, 5570, 5571, 5572, 5573, 5574, 5575, 5576, 5577, 5578, 5579, 5580, 5581, 5582, 5583, 5584, 5585, 5586, 5587, 5588, 5589, 5590, 5591, 5592, 5593, 5594, 5595, 5596, 5597, 5598, 5599, 5600, 5601, 5602, 5603, 5604, 5605, 5606, 5607, 5608, 5609, 5610, 5611, 5612, 5613, 5614, 5615, 5616, 5617, 5618, 5619, 5620, 5621, 5622, 5623, 5624, 5625, 5626, 5627, 5628, 5629, 5630, 5631, 5632, 5633, 5634, 5635, 5636, 5637, 5638, 5639, 5640, 5641, 5642, 5643, 5644, 5645, 5646, 5647, 5648, 5649, 5650, 5651, 5652, 5653, 5654, 5655, 5656, 5657, 5658, 5659, 5660, 5661, 5662, 5663, 5664, 5665, 5666, 5667, 5668, 5669, 5670, 5671, 5672, 5673, 5674, 5675, 5676, 5677, 5678, 5679, 5680, 5681, 5682, 5683, 5684, 5685, 5686, 5687, 5688, 5689, 5690, 5691, 5692, 5693, 5694, 5695, 5696, 5697, 5698, 5699, 5700, 5701, 5702, 5703, 5704, 5705, 5706, 5707, 5708, 5709, 5710, 5711, 5712, 5713, 5714, 5715, 5716, 5717, 5718, 5719, 5720, 5721, 5722, 5723, 5724, 5725, 5726, 5727, 5728, 5729, 5730, 5731, 5732, 5733, 5734, 5735, 5736, 5737, 5738, 5739, 5740, 5741, 5742, 5743, 5744, 5745, 5746, 5747, 5748, 5749, 5750, 5751, 5752, 5753, 5754, 5755, 5756, 5757, 5758, 5759, 5760, 5761, 5762, 5763, 5764, 5765, 5766, 5767, 5768, 5769, 5770, 5771, 5772, 5773, 5774, 5775, 5776, 5777, 5778, 5779, 5780, 5781, 5782, 5783, 5784, 5785, 5786, 5787, 5788, 5789, 5790, 5791, 5792, 5793, 5794, 5795, 5796, 5797, 5798, 5799, 5800, 5801, 5802, 5803, 5804, 5805, 5806, 5807, 5808, 5809, 5810, 5811, 5812, 5813, 5814, 5815, 5816, 5817, 5818, 5819, 5820, 5821, 5822, 5823, 5824, 5825, 5826, 5827, 5828, 5829, 5830, 5831, 5832, 5833, 5834, 5835, 5836, 5837, 5838, 5839, 5840, 5841, 5842, 5843, 5844, 5845, 5846, 5847, 5848, 5916, 5917, 5918, 5919, 5920, 5921, 5922, 5923, 5924, 6016, 6017, 6019, 6021, 6022, 6025, 6026, 6027, 6028 
<223> /mod_base = "unknown nucleotide" 
  
<400> 678 
aggttatgtaagggtttgctttcaccccattcaaaagatacctcttcctcttctcttgct 60 
ccctcttgccctcattcttgtgcctgtgcagacatttgagtagaggcgaatcactttcac 120 
ttctgctggggaaattgcaacacgcttctttaaatggcagagagaaggagaaaacttaga 180 
tcttctgataccaaatcactgaaccttggaaggtcagaaatctttcaagccctgcaggac 240 
cgtaaaatgcccatgtnnccaacagaagcactggggcatgagtggggaaggaatagaaac 300 
agagtcagaaaggggataagagaagaataaaagggaaagtggtgaaggcagggaggcaaa 360 
ttgcttagtgtgaatatgcacgcgttcatttagttttcaaatccttgttgagcatgataa 420 
agttcccagcatcaatcctcacgtgttggtttccgttaggatctgcctgggggaatatct 480 
gctgaatcagtgactctgagctgaaccaggaaattcaccatgattaggagagtagctgtg 540 
ttagtcagggtctctaccnnaaaaaaagttatacccaagagacaggatcttctcatccaa 600 
aattttcttcacttctgaaattctctggtttgtgctcatcattggcagctatttgttcat 660 
caagagttgtgtagttggcttcttctggaaaaaggaatctgcgtcatatctaagtcagat 720 
ttcattctggtgctctcagagcagttagcccaggaagggggccggcttctgtggctactg 780 
gtgcagaggcagatgcagtttgtgtcccacagatattaacttcaataagcacttaatgag 840 
ggccttccctgtgcgagaatggggaggaacaaaatgcagctcnnnnnnnnnnnnnnnnnn 900 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 960 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnacttctctcccagtgcgagagcgcggcgg 1020 
cggcagctgaagacccggccgcccagacgatgcggtggtgggggacctgccggcacgcga 1080 
ctccccccgggcccaaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 1140 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 1200 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 1260 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 1320 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 1380 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 1440 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccttctgcg 1500 
ttcacacgctaagttgtttatctctgctgcggcaggagctgcggacggtggcgggcgagc 1560 
ggctcctctgtcagagttgatattcactgatggactccaaagaatcattaactcccagta 1620 
gagaagaaaaccccagcagtgtgcttgctcaggagaggggaaatgtgatggacttctata 1680 
aaaccctaaggggaggagctactgtgaaggtttctgcatcttcaccctcactggctgtcg 1740 
cttctcagtcagactccaagcagcgaagacttttggttgattttccaaaaggctcagtaa 1800 
gcaatgcgcagcagccagatctctccaaagcagtttcactctcaatgggactgtatatgg 1860 
gagagacagaaacaaaagtgatgggaaatgacctgggattcccacagcagggccaaatca 1920 
gcctttcctcgggggaaacagacttaaagcttttggaagaaagcattgcaaacctcaata 1980 
ggtcgaccagtgttccagagaaccccaagagttcagcatccactgctgtgtctgctgccc 2040 
ccacaaagaaggagtttccaaaaactcactctgatggatcttcagaacagcaaaatttga 2100 
agggccatactggcaccaacggcggcaatgtgaaattgtataccgcagaccaaagcacct 2160 
ttgacattttgcaggatttggagttttcttctgggtccccaggtaaagagacgaatgaga 2220 
gtccttggagatcagacctgttgatagatgaaaactgtttgctttctcctctggcgggag 2280 
aagacgattcattccttttggaaggaaattcgaacgaggactgtaagcctctcattttac 2340 
cggacactaaacccaaaattaaggataatggagatctggttttgtcaagccccaataatg 2400 
caacactgccccaagtgaaaacagaaaaagaagatttcatcgaactctgcacccctgggg 2460 
taattaagcaagagaaactgggcacagtttactgtcaggcaagctttcctggagcaaata 2520 
taattggtaataaaatgtctgccatttctgttcatggtgtgagtacctctggaggacaga 2580 
tgtaccactatgacatgaatacagcatccctttctcaacagcaggatcagaagcctattt 2640 
ttaatgtcattccaccaattcccgttggttctgaaaattggaataggtgccaaggnnnnn 2700 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2760 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2820 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagcatcaggat 2880 
gtcattatggagtcttaacttgtggaagctgtaaagttttcttcaaaagagcagtggaag 2940 
gtagacagcacaattacctatgtgctggaaggaatgattgcatcatcgataaaattcgaa 3000 
gaaaaaactgcccagcatgccgctatcgaaaatgtcttcaggctggaatgaacctggaag 3060 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 3120 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaccacaactcaccc 3180 
ctaccctggtgtcactgttggaggttattgaacctgaagtgttatatgcaggatatgata 3240 
gctctgttccagactcaacttggaggatcatgaccacgctcaacatgttaggagggcggc 3300 
aagtgattgnnnnnnnnnnnnnnnnnnnnnnnnnnncaggtttcaggaacttacacctgg 3360 
atgaccaaatgaccctactgcaatactcctggatgtttcttatggcatttgccctggggt 3420 
ggagatcatatagacaatcaagtgcaaacctgctgtgttttgctcctgatctgattatta 3480 
atgagtanagtntgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 3540 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 3600 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 3660 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 3720 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntctntgcangnngtggttg 3780 
aaaatcttcttaactattgcttccaaacatttttggataagaccatgannnnnnnnnnnn 3840 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 3900 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 3960 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 4020 
nnnnnnnnnnnnnnnnnnnnnnngttttgttttaaatacgcactacatgtggtttataga 4080 
gggccaagacttggcaacagaagcaattgagtcnnnatcacttttcagtgatgggagagt 4140 
agacggtgaaatttcattagttagtatatcccagaaattagaaaccttaatatgtggacg 4200 
taatctccatagtcaaagaaggatggcacctaaaccaccagtgcccaaagtctgtgtgaa 4260 
gaactttctgctncatacntttttncacagttggctggatgaaattttctagactttctg 4320 
ttggtgtatnccccccctgtatagttaagatagcatttttgatttatgcatggaaacctg 4380 
aaaaaaagtttacaagtgtatatcagaaaagggaagttgtgccttttatagctattactg 4440 
tctggttttaacaatttcctttatatttagtgaactacgcttgctcattttttcttacat 4500 
aatttttttattcaagttattgtannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 4560 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 4620 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 4680 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 4740 
nnnnnnnnaaattacaccgtcctaactggtatngagcacctagtccagggacctgctggg 4800 
taaactgtggatgatggttgcaaaagactgatttaaaaantcactaccaagaggccctgt 4860 
ctgtacctaatgccctatttttgcaaaggctatatggcaagaaagctggtaaactatttg 4920 
tctttcaggaccttttgaagtagtttgtataacttcttaaaagttgtgattccagacaac 4980 
cagctgtaacacagctgagagaattttaatcggagcnaagtaattcctctcactaaactt 5040 
tacccaaaaactaaatctctaatatggcaaaaatggctagacacccattttcacattccc 5100 
atctgtcaccaattggttaatctttcctgatggtacaggaaagctcagctactgattttt 5160 
gtgatttagaactgtatgtcagacatccatgtttgtaaaactacacatccctaatgtgtg 5220 
ccatagagtttaacacaagtcctgtgaatttcttcactgttgaaaattattttaaacaaa 5280 
atagaagctgtagtagccctttctgtgtgcaccttaccaactttctagtaaactcaaaac 5340 
ttaacatatttactaagccacaagaaatttgatttctattcaaggtggccaaattatttg 5400 
tgtaatagaaaactgaaaatctaatattaaaaatatggaacttctaatatatttttatat 5460 
ttagttatagtttcagatatatatcatattggtattcactaatctgggaagggaagggct 5520 
actgcagctttacatgcaatttattaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 5580 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 5640 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 5700 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 5760 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 5820 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnttccaacagtgagtctgtcagtgcaggtttag 5880 
tttactcaatttccccttgcactaaagtatgtaaannnnnnnnncaggagacaggaaagt 5940 
ggtgcttacatacttaaaggcaccatctaatagtgggttactttcaacatacaggcctcc 6000 
cccagcagttgaatgnnancnnaannnncagaagtttggcaatagtttgcatagaggtac 6060 
cagcaatatgtaaatagtgcagaatctcataggttgccaataatacactaattcctttct 6120 
atc                                                          6123 

 
<210>	679
<211>	6345
<212>	DNA
<213>	Mus musculus
 
<220>	 
<223>	cDNA sequence of mouse NR3C1

<300>
<308>	NM_008173.3
<309>	2009-04-19
 
<400>	679
ttaatatttgccaatggactccaaagaatccttagctccccctggtagagacgaagtccc	60
cagcagtttgcttggccgggggaggggaagcgtgatggacttgtataaaaccctgagggg	120
tggagctacagtcaaggtttctgcgtcttcaccctcagtggctgctgcttctcaggcaga	180
ttccaagcagcagaggattctccttgatttttcaaaaggctcagcaagcaatgcgcagca	240
gcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagccgcagccagattt	300
atccaaagccgtttcactgtccatgggactgtatatgggagagaccgaaacaaaagtgat	360
ggggaatgacttgggctacccacagcagggccagcttggcctctcctctggggaaacaga	420
ctttcggcttctggaagaaagcattgcaaacctcaataggtcgaccagccgtccagagaa	480
ccccaagagttcaacacctgcagctgggtgtgctaccccgacagagaaggagtttcccca	540
gactcactctgatccatcttcagaacagcaaaatagaaaaagccagcctggcaccaacgg	600
tggcagtgtgaaattgtataccacagaccaaagcacctttgacatcttgcaggatttgga	660
gttttctgccgggtccccaggtaaagagacaaacgagagtccttggaggtcagacctgtt	720
gatagatgaaaacttgctttctcctttggcgggagaagatgatccattccttctggaagg	780
ggacgtgaatgaggattgcaagcctcttattttaccggacactaaacctaaaattcagga	840
tactggagatacaatcttatcaagccccagcagtgtggcactgccccaagtgaaaacaga	900
gaaagatgatttcattgagctttgcacccctggggtaattaagcaagagaaactgggccc	960
ggtttattgccaggcaagcttttctgggacaaatataattgggaataaaatgtctgccat	1020
ttctgttcatggcgtgagtacctctggaggacagatgtaccactatgacatgaatacagc	1080
atccctttctcagcagcaggatcagaagcctgtttttaatgtcattccaccaattcctgt	1140
tggttctgaaaactggaataggtgccaagggtctggagaggacaacctgacttccttggg	1200
ggctatgaacttcgcaggccgctcagtgttttctaatggatattcaagccctggaatgag	1260
accagatgtgagttctcctccgtccagctcctccacagcaacgggaccacctcccaaact	1320
ctgcctggtgtgctccgatgaagcttcgggatgccattatggggtgctgacgtgtggaag	1380
ctgtaaagtcttctttaaaagagcagtggaaggacagcacaattacctttgtgctggaag	1440
aaatgattgcatcattgataaaattcgaagaaaaaactgtccagcatgccgctatcgaaa	1500
atgtcttcaagctggaatgaacctggaagctcgaaaaacgaagaaaaaaattaaaggaat	1560
tcagcaagccactgcaggagtctcacaagacacttctgaaaacgctaacaaaacaatagt	1620
tcctgccgcgctgccacagcttacccctaccctggtgtcactgctggaggtgatcgagcc	1680
tgaggtgttatatgcaggatatgacagctctgttccagactcagcatggagaattatgac	1740
cacgctcaacatgttaggtgggcgccaagtgattgccgcagtgaaatgggcaaaggcgat	1800
accaggattcagaaacttacacctggatgaccaaatgacccttctacagtactcatggat	1860
gtttctcatggcatttgccctgggttggagatcatacagacaagcaagtggaaacctgct	1920
atgctttgctcctgatctgattattaatgagcagagaatgactctaccctgcatgtatga	1980
ccaatgtaaacacatgctgtttatctccactgaattacaaagattgcaggtatcctatga	2040
agagtatctctgtatgaaaaccttactgcttctctcctcagttcctaaggaaggtctgaa	2100
gagccaagagttatttgatgagattcgaatgacttatatcaaagagctaggaaaagccat	2160
tgtcaaaagggaaggaaactccagtcagaattggcagcggttttatcaactgacaaaact	2220
tttggactccatgcatgatgtggttgaaaatctccttagctactgcttccaaacattttt	2280
ggataagtccatgagtattgaattcccagagatgttagctgaaatcatcactaatcagat	2340
accaaaatactcaaatggaaatatcaaaaagcttctgtttcatcagaaatgactgcctta	2400
ctaagaaaggctgccttaaagaaagttgaatttatagcttttactgtacaaacttatcaa	2460
cttgtcttgtagatgttttgtcgttctttttgtttgtcttgtttgttttctatacgcact	2520
acatgtggtctctagagggccaagacttggcaacagaagcagatgagccatcacttttca	2580
gtgacaggaaagcagacagtgatgtgcattggctggtgtatcacagaaactagaacagtt	2640
agtggagacatgtccactatcagagaaggaccgcacctgaaccaccagtgcccaaagtcc	2700
atgtgatcaactttctgctcaactttcagttggctggataacactttctagacttttctg	2760
ttggtgtatttttcccatgtatagttaggatagcattttgatttatgcatggaaacctga	2820
aaaaagtttacacgtgtatatcagaaaagggaagttgtgccttttatagctattactgtc	2880
tggttttaacaatttcctttatattcagtgaactatgcttgctcgtttttcttaaataat	2940
ttttgtattctagttattgtatagctgtttaagatgggcagctgcctcacagctctccta	3000
gacgctaacattaatttccgtgtgaaaatgggtcggtgctcctaccctgatggcactcag	3060
ctatcagaagaccacagaaattgactcagatctccagtattcttgtcaaaagctcttact	3120
ctgtatatatctgcttccatggggaattatataggttgtgcagattaaccgtcctaactg	3180
gtatagagcacctagtccagtgacctgctgggtaaactgtggatgatggttacaaaagac	3240
taattgtaaaacagtgcccaccaacaggccccgtttgcacccaatgcaccatctcttcag	3300
tggtgcgatagcaacaaagtttgtaactcagctctttcaggaccttcgggagtagtttgt	3360
gtaacattttaaaatgtattattccagataaccagctgtgataaagccgagagattgttt	3420
taatcagaccaagtaacttctctcattaaacgttaccctcaactaagtctctaatatggc	3480
aagaatggctagacacccattttcacatcccacctgtcaccaattggtctagctttcctg	3540
gtggtacaggaaaatcagctactgattttttgttatttagaactgaatgtcaggcatcca	3600
tgtttgtccaactatacatccctacatgtgccatagaatctaacacaagtcttgtgaact	3660
tcttcacactgagagttatcattttaaacaaaacagaagctgtagtagccctttctgtgt	3720
gcaccttaccaactttctgtgactcaaagcttaacacacttactaagccacaagaaatct	3780
gatttctacttaaggtggccaaattatttgtgtaatagaaaactgaaaatctaatattaa	3840
aaatatgaaacttctaatatatttttatatttagttctagtttcagatatatatcatatt	3900
ggtattcactaatctgggaagggaagggctactgcagctgtacatgcaatttattaacat	3960
gattgtaaaatagctgtatagtgtaaaataagaatgatttttagatgagattgttttatc	4020
atgacatgttatatattttttgtaggggtcaaagaaatgttgatggatatcctataagat	4080
ttatagtatataagagcatccatacaggcctcagtggtcttggaaattaaaacaggtttg	4140
ctctaagctagggagagggagctgggactggccctgtgtgcagtgcaggtcctgagggtt	4200
tgacccgatcagatcacaggggaactaattccctcccatctaaccatcctcatccgacca	4260
tggccctgtcagtgcaggctggctttattaaatccaggacagaaaggtggcgcttatgta	4320
cttagaggcaccgtccagtaacagggttgttcccacatgcagcctccgcacgggttaaca	4380
gaaacagaggctttagaagtttggcaataatgtgcatagaggttccagcaatatgtaaat	4440
actaaagaatcgcataggaagccaataatacactaatcctctccatcctacaagagtcca	4500
tttccaagtaagatgaggacatgtttatgttttctttgaatgctttttgaatgttgttat	4560
tttcagtattttgcagaaattatttaataaaaaaaagtataatcatttgctttttgaatt	4620
ctctctaaaagggaatgttcagtttgtaatggtttaaattggtctcaaagtactttaaaa	4680
taattgtaacccagctggatgtgaaatttatggtgcctaagaaataccacttgaagatta	4740
tcaatgacagtgttaagtttcaaaatgagcttctcaaaaatagattattgtacatttatg	4800
gaatgttatatggttaaacccaaaaagcacatcacacataaatctgctttcagttccaac	4860
cagcttggctttcaaaaatagagctccaaaaaaaaaaaaggaaaaaaaagatatatatgc	4920
tttgttattaacagaaggcagcagacattcataaaactactatcggaagttttccattag	4980
atgtataaagagctatcctttggtatgtgggaaagaagaaagctgtcataattctgattg	5040
agtataagtgagagagatacggtactgtttgagagcagctccttttctgcgtgtggcttc	5100
ataccgttccaaactatgtagattttataatagcttcagtgagaattggtaacatgcctg	5160
tatgactcacaacagatcttgaaaactatctttaattactggtaggacaaaaagggacat	5220
tctggttattttaggcactggcttggaacactgtatatgcagaagaaagaagacaggcaa	5280
tctggggaaaggaaggggacctgggaagcactgccttctttaaggaaagacacaccaata	5340
gatgagatcatcccaaaggcacagggaccacagagtgtgagtccttagtgacgagtcagg	5400
tgagctctggtgagcttggagaagccagccccaccagcagagcaggcacggcagggatgg	5460
gacaagcagggacgacaattccagctggacactggtcccagtattttgctccctcttata	5520
taccgtgaggcagtatcaccgtgggatgaaccatggtagcacgttttgatctgtcagcac	5580
tcaaggatcatggtagccttcgggagctttaggttttggttggtcaccccaacgatcagc	5640
tgtagttgaatgtgtttcttatgtgcctggtttcagtgttagaaggtgaaatagagtgtg	5700
caaaggacactgcaaaccacttcggatggaagttttctcattttccagactattttcggt	5760
cagcctggtctatcaagatcggtaaccaggtcttcaggaaagggttggcttctatctagg	5820
acatgcctgaaaggattttattttctgataaatggctgtatgaaaataccctcctaaata	5880
ccctgcttaactacatatagatttcagtgtgtcaatattctattttgtatattaaacaaa	5940
tgctatataatggggacaaatctatattatactgtgtatggcattattaagaagcttttt	6000
cattattttttatcacagtaatttttaaatgtgtaaaaattaaaaaccagtgactcctgt	6060
ttaaaaataaaagttgtagttttttattcatgctgaataacctgtagtttaaaaacctgt	6120
ctttctactacacagtgagatgtcagactgtaaagttttgtgtggaaatgtttaactttt	6180
atttttcatttcaatttgctgttctggtattaccaaaccacacatttgtaatgaattggc	6240
agtaaatgttagtcagccatttacagcaatgccaaatatggataaacatcataataaaag	6300
tatctgctttttcattatgtgactcccaaaaaaaaaaaaaaaaaa                 	6345
 
 
<210>	680
<211>	6285
<212>	DNA
<213>	Rattus norvegicus
 
<220>	 
<223>	cDNA sequence of rat NR3C1

<300>
<308>	NM_012576.1
<309>	2007-09-17

<400>	680
gacgctgcgggggtgggggacctcggcggcacggagtccccccccgggctcacattaata	60
tttgccaatggactccaaagaatccttagctccccctggtagagacgaagtccctggcag	120
tttgcttggccaagggagggggagcgtaatggacttttataaaagcctgaggggaggagc	180
tacagtcaaggtttctgcatcttcgccctcagtggctgctgcttctcaggcagattccaa	240
gcagcagaggattctccttgatttctcgaaaggctccacaagcaatgtgcagcagcgaca	300
gcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagccagg	360
cttatccaaagccgtttcactgtccatggggctgtatatgggagagacagaaacaaaagt	420
gatggggaatgacttgggctacccacagcagggccaacttggcctttcctctggggaaac	480
agactttcggcttctggaagaaagcattgcaaacctcaataggtcgaccagcgttccaga	540
gaaccccaagagttcaacgtctgcaactgggtgtgctaccccgacagagaaggagtttcc	600
caaaactcactcggatgcatcttcagaacagcaaaatcgaaaaagccagaccggcaccaa	660
cggaggcagtgtgaaattgtatcccacagaccaaagcacctttgacctcttgaaggattt	720
ggagttttccgctgggtccccaagtaaagacacaaacgagagtccctggagatcagatct	780
gttgatagatgaaaacttgctttctcctttggcgggagaagatgatccattccttctcga	840
agggaacacgaatgaggattgtaagcctcttattttaccggacactaaacctaaaattaa	900
ggatactggagatacaatcttatcaagtcccagcagtgtggcactaccccaagtgaaaac	960
agaaaaagatgatttcattgaactttgcacccccggggtaattaagcaagagaaactggg	1020
cccagtttattgtcaggcaagcttttctgggacaaatataattggtaataaaatgtctgc	1080
catttctgttcatggtgtgagtacctctggaggacagatgtaccactatgacatgaatac	1140
agcatccctttctcagcagcaggatcagaagcctgtttttaatgtcattccaccaattcc	1200
tgttggttctgaaaactggaataggtgccaaggctccggagaggacagcctgacttcctt	1260
gggggctctgaacttcccaggccggtcagtgttttctaatgggtactcaagccctggaat	1320
gagaccagatgtaagctctcctccatccagctcgtcagcagccacgggaccacctcccaa	1380
gctctgcctggtgtgctccgatgaagcttcaggatgtcattacggggtgctgacatgtgg	1440
aagctgcaaagtattctttaaaagagcagtggaaggacagcacaattacctttgtgctgg	1500
aagaaacgattgcatcattgataaaattcgaaggaaaaactgcccagcatgccgctatcg	1560
gaaatgtcttcaggctggaatgaaccttgaagctcgaaaaacaaagaaaaaaatcaaagg	1620
gattcagcaagccactgcaggagtctcacaagacacttcggaaaatcctaacaaaacaat	1680
agttcctgcagcattaccacagctcacccctaccttggtgtcactgctggaggtgattga	1740
acccgaggtgttgtatgcaggatatgatagctctgttccagattcagcatggagaattat	1800
gaccacactcaacatgttaggtgggcgtcaagtgattgcagcagtgaaatgggcaaaggc	1860
gatactaggcttgagaaacttacacctcgatgaccaaatgaccctgctacagtactcatg	1920
gatgtttctcatggcatttgccttgggttggagatcatacagacaatcaagcggaaacct	1980
gctctgctttgctcctgatctgattattaatgagcagagaatgtctctaccctgcatgta	2040
tgaccaatgtaaacacatgctgtttgtctcctctgaattacaaagattgcaggtatccta	2100
tgaagagtatctctgtatgaaaaccttactgcttctctcctcagttcctaaggaaggtct	2160
gaagagccaagagttatttgatgagattcgaatgacttatatcaaagagctaggaaaagc	2220
catcgtcaaaagggaagggaactccagtcagaactggcaacggttttaccaactgacaaa	2280
gcttctggactccatgcatgaggtggttgagaatctccttacctactgcttccagacatt	2340
tttggataagaccatgagtattgaattcccagagatgttagctgaaatcatcactaatca	2400
gataccaaaatattcaaatggaaatatcaaaaagcttctgtttcatcaaaaatgactgcc	2460
ttactaagaaaggttgccttaaagaaagttgaatttatagcttttactgtacaaacttat	2520
caatttgtcttgtagatgttttgttgttctttttgtttctgtcttgttttgttttaaaca	2580
cgcagtacatgtggtttatagagggccaagacttggcgacagaagcagttgagtcaacac	2640
tctgaagtgatgacacagcacacagtgaagtgtattgttggtgtatcacagaaactaaca	2700
gttacgtggaggcatggccactgtcagagagggaccgcacctaaaccaccgtgcccaagt	2760
ccatgtggttcaactttctgactcagaactttacagttggctgggtaaaactttctagac	2820
tttctgttggtgtatttttcccatgtatagttaggatggtattttgatttatgcatgcaa	2880
acctgaaaaaagtttacaagtgtatatcagaaaagggaagttgtgccttttatagctatt	2940
actgtctggttttaacaatttcctttatattcagtgaactatgcttgctcgtttctcttc	3000
aataatttttgtattccagttattgtacagctgtttaagatgggcagctgcttcacagct	3060
ttcctagacgctaacattaatttccgtgtgaaaatgggtcggtgcttctaccctgttggc	3120
accagctatcagaagaccacagaaattgactcagatctccagtattcttgttaaaaagct	3180
cttactctgtatatatctgcttccatggagaattacataggctgagcagattacataggc	3240
tgagcagattaaccgtcctaactggtgtagagcacctagtccagtgaccttctgggtaaa	3300
ccgtggatgatggttacagaagactggtgggaaaacagtaactaccaaaaggcccctttc	3360
catctaatgcaccatctcttcaatggggagatagcaaccaagcccgtaaatcagctcttt	3420
caggaccttctggagtggtttgcataacattttaaaatgtattattccagatagccagct	3480
ctgataaagccgagagattgtttaatcagaccaagtaacttctctcattaaacttacccc	3540
caactaaatcgctaatacagcaagaatggctagacacccattttcacatctcacccgcac	3600
cgattggtctagctctcatggtggtcaggagaatcagctactgatttttgttacttagaa	3660
tttcaggactcgcattttccctacacatccctacatgtgccatagaatttaacacaagtc	3720
ctgtgaacttcttcacattgagaattatcattttaaacaaaacagaagcagtagtagccc	3780
tttcttgtgcaccttaccctttcttgactcaaagcttaatatgcttactaagccacaaga	3840
aatcgatttcacttaaaggcgccaaattatttgtgtaatagaaaaactgaaaatctaata	3900
ttaaaaatatgaaacttctaatatatttttatatttagttatagtttcgatatatatcat	3960
atcggtattcactgatcttgggaaagggaaagggctactgcagctttacatgcaatttat	4020
taactgactgtaaaatagctgtatagtaataagaatgacttttagtgagattgctttatc	4080
atgacatgttatatatttttcgtaggggtcaaagaaatattgatggatatgatagcctat	4140
atgatttaatgtatataaaagcatcaaacaggccttaacgcgtcttggaaaaaaatacct	4200
ttgttctaagctagggaagggagcggagaggccccgtgtgtatggaggttccgaggctcg	4260
gataagagatcaaggggatctaattcctacctccatctaattacctcaccacccatgatc	4320
ctgtcagtgaggggttattaaatcccccgttatactaatataaataggaagaagggtggc	4380
gctcacgtctgttccaggcgccgcagtagcagggttattttccatgcagcctcccgacaa	4440
ggttagcagagggaggctttggcaagtttggcgtggcgtgcatagaggcaccagcaacat	4500
gtaaacctaaagagcccataggaagccaagaatacactaatcctccccacccttcaatag	4560
tccatttccaagtaagatgaggacatgcttatgttttctttgaatgcttttagaatgttg	4620
ttattttcagtattttgcagaaattatttaataaaaaagtataatttgaattctctctaa	4680
aagggattgttcagtttgtaatggtttaaattggtctcaaagtactttaagataattgta	4740
acccagctggatgtgaaatttatggtgcctaagaaataccacttgaatattatcaagaca	4800
gtgttaagttttaaaatgagcttctcaaaaatagattattgtacatttatggaatgttat	4860
atggttaaacccaaaaaagcacatcacacataaatctgctttcagcttggctttcaaaaa	4920
tagagctccaaaaacgaaaaaggagaagaaaaagtatatatatgcgttgttattaacaga	4980
aggcaacagacattcataaaactactaccgaagctttccttgaagcgtataaagagccat	5040
gctcctttagtatgtggggaagaagagagccgtcatagtttcgagtacagagagaagatg	5100
cggtactgtctccgtgtgtggcttcataccgttcctaactatttaggtttataataactt	5160
cagtgagactcggtgacatgcctgtatgactcatgaccgatcttgaaagatatctttaat	5220
tactggtaggacaaaagggacactctggttattttaggccttggcttgggatactgtata	5280
tccagaagaaaggagacaggaaacttggggaagggaagggaacctaggaagcactgcctt	5340
ctgtaggaaagaacacaccaataagtgagagtacccaaagggacaaggccacacagtgtg	5400
gggtctaaggatgagtcagggtgagctctggtgggcatggagaagccagcaactccagtg	5460
ctacagagcagggcagggcagggatgggacaagatggatgcggatcccagtcccagtagt	5520
ttgctccctcttatttaccatgggatgaaccatggagtattgatctgtcagcactcaagg	5580
atcatggagcttgagattccggttggtcaccccaacggtaagctgagattgaatgtgttt	5640
cttatgtgccggtttcagtgttagaaggcgaaacagagtgtacagaagacactgcaaacc	5700
ggtcagatgaaagtcttctcattcccaaactattttcagtcagcctgctctatcaggact	5760
ggtgaccagctgctaggacagggtcggcgcttctgtctagaatatgcctgaaaggatttt	5820
attttctgataaatggctgtatgaaaataccctcctcaataacctgcttaactacataga	5880
gatttcagtgtgtcaatattctattttgtatattaaacaaaggctatataatggggacaa	5940
atctatattatactgtgtatggcattattaagaagcttttaattttttatcacagtaatt	6000
tttaaatgtgtaaaaaattaaaaattagtgatccgtttaaaaataaaagttgtagttttt	6060
tattcatgctgaataacctgtagtttaaaaatccgtctttctacctacaagtgaaatgtc	6120
agacgtaaaattttgtgtggaaatgtttaacttttatttttctttaaatttgctgtcttg	6180
gtattaccaaaccacacattgtactgaattggcagtaaatgttagtcagccatttacagc	6240
aatgccaaatatggataaacatcataataaaatatctgctttttc                 	6285
 
 
<210>	681
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: sense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 5, 7, 8, 12, 14, 15, 16, 17
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	4, 6, 9, 10, 11, 13, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	681
cuuacgcuga guacuucgat t	21
 
 
<210>	682
<211>	21
<212>	DNA
<213>	Artificial sequence
 
<220>	 
<223>	Description of the Artificial sequence: antisense strand of dsRNA
 
<220>	 
<221>	modified_base
<222>	1
<223>	/mod_base = "nucleoside: lacks 5'-phosphate group"
 
<220>	 
<221>	modified_base
<222>	7, 11, 16
<223>	/mod_base = "2'-O-methyl corresponding nucleoside"
 
<220>	 
<221>	modified_base
<222>	21
<223>	/mod_base = "5'-phosphorothioate thymidine"
 
<220>	 
<221>	modified_base
<222>	1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 14, 15, 17, 18, 19
<223>	/mod_base = "2'-hydroxy corresponding nucleoside"
 
<400>	682
ucgaaguacu cagcguaagt t	21
 
  
<210> 683 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223>   Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 683 
gaatttgcca tgggtggaat tttttctctt ggaaagaaag t 41 
 
 
  
  
<210> 684 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223>   Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 684 
ggagggatct cgctcctgga tttttctctt ggaaagaaag t 41 
 
 
  
  
<210> 685 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223>   Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 685 
ccccagcctt ctccatggtt ttttctcttg gaaagaaagt  40 
 
 
  
  
<210> 686 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223>   Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 686 
gctcccccct gcaaatgagt ttttctcttg gaaagaaagt  40 
 
 
  
  
<210> 687 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223>   Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 687 
agccttgacg gtgccatgtt tttaggcata ggacccgtgt ct 42 
 
 
  
  
<210> 688 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223>   Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 688 
gatgacaagc ttcccgttct ctttttaggc ataggacccg tgtct 45 
 
 
  
  
<210> 689 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223>   Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 689 
agatggtgat gggatttcca tttttttagg cataggaccc gtgtct 46 
 
 
  
  
<210> 690 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223>   Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 690 
gcatcgcccc acttgatttt tttttaggca taggacccgt gtct 44 
 
 
  
  
<210> 691 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223>   Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 691 
cacgacgtac tcagcgccat ttttaggcat aggacccgtg tct 43 
 
 
  
  
<210> 692 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223>   Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 692 
ggcagagatg atgacccttt tgtttttagg cataggaccc gtgtct 46 
 
 
  
  
<210> 693 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223>   Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 693 
ggtgaagacg ccagtggact c 21 
 
 
  

  
<210> 694 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 694 
tcccatgcta attatccagc actttttctc ttggaaagaa agt 43 
 
 
  
  
<210> 695 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 695 
tggcatgccc agagctcatt tttctcttgg aaagaaagt 39 
 
 
  
  
<210> 696 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 696 
ggagcgtggc tttccttcat ttttctcttg gaaagaaagt  40 
 
 
  
  
<210> 697 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 697 
ccctgcctct gaattctgaa gtttttctct tggaaagaaa gt 42 
 
 
  
  
<210> 698 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 698 
cctccttaca cttttatttc ccttcttttt ctcttggaaa gaaagt 46 
 
 
  
  
<210> 699 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 699 
ttttctagag agaagcaaat cctttttttt ctcttggaaa gaaagt 46 
 
 
  
  
<210> 700 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 700 
gagggtattt tcatacagcc tttctttttc tcttggaaag aaagt 45 
 
 
  
  
<210> 701 
<211> 52 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 701 
ttcatagaca caaatcatgt tagttttctt tttaggcata ggacccgtgt ct 52 
 
 
  
  
<210> 702 
<211> 47 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 702 
tccatggtga tgtagttttc aggtttttag gcataggacc cgtgtct 47 
 
 
  
  
<210> 703 
<211> 50 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 703 
acaaaaacac attcacctac agctactttt taggcatagg acccgtgtct  50 
 
 
  
  
<210> 704 
<211> 49 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 704 
tgacactaaa accagacaca cacacttttt aggcatagga cccgtgtct 49 
 
 
  
  
<210> 705 
<211> 55 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 705 
aatctatatg tagttaagca agttatttga gtttttaggc ataggacccg tgtct 55 
 
 
  
  
<210> 706 
<211> 24 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 706 
gacttaggtg aaactggaat tgct 24 
 
 
  
  
<210> 707 
<211> 27 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 707 
gtttttaaaa gggaactaaa attatga 27 
 
 
  
  
<210> 708 
<211> 31 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GCR 
  
<400> 708 
gatcaatgta ttgtataaca atatttttca t 31 
 
 
  

  
<210> 709 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 709 
atctggtctc attccagggc ttttttctct tggaaagaaa gt 42 
 
 
  
  
<210> 710 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 710 
caggcagagt ttgggaggtg gtttttctct tggaaagaaa gt 42 
 
 
  
  
<210> 711 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 711 
ttccaggttc attccagctt gtttttctct tggaaagaaa gt 42 
 
 
  
  
<210> 712 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 712 
tttttttctt cgtttttcga gctttttctc ttggaaagaa agt 43 
 
 
  
  
<210> 713 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 713 
agtggcttgc tgaattcctt taatttttct cttggaaaga aagt 44 
 
 
  
  
<210> 714 
<211> 47 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 714 
ggaactattg ttttgttagc gttttctttt tctcttggaa agaaagt 47 
 
 
  
  
<210> 715 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 715 
tcccgttgct gtggaggatt tttaggcata ggacccgtgt ct 42 
 
 
  
  
<210> 716 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 716 
ccgaagcttc atcggagcac actttttagg cataggaccc gtgtct 46 
 
 
  
  
<210> 717 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 717 
cagcacccca taatggcatc tttttaggca taggacccgt gtct 44 
 
 
  
  
<210> 718 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 718 
tccagcacaa aggtaattgt gctttttagg cataggaccc gtgtct 46 
 
 
  
  
<210> 719 
<211> 49 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 719 
ttttatcaat gatgcaatca tttctttttt aggcatagga cccgtgtct 49 
 
 
  
  
<210> 720 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 720 
aagacatttt cgatagcggc atttttaggc ataggacccg tgtct 45 
 
 
  
  
<210> 721 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 721 
gctggacgga ggagaactca c 21 
 
 
  
  
<210> 722 
<211> 24 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 722 
gaagacttta cagcttccac acgt 24 
 
 
  
  
<210> 723 
<211> 23 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 723 
tgtccttcca ctgctctttt aaa 23 
 
 
  
  
<210> 724 
<211> 23 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 724 
tgctggacag ttttttcttc gaa 23 
 
 
  
  
<210> 725 
<211> 24 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GCR 
  
<400> 725 
agaagtgtct tgtgagactc ctgc 24 
 
 
  

  
<210> 726 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GAPDH 
  
<400> 726 
caaatggcag ccctggtgat ttttctcttg gaaagaaagt  40 
 
 
  
  
<210> 727 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GAPDH 
  
<400> 727 
ccttgactgt gccgttgaat tttttttctc ttggaaagaa agt 43 
 
 
  
  
<210> 728 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GAPDH 
  
<400> 728 
gtctcgctcc tggaagatgg tttttctctt ggaaagaaag t 41 
 
 
  
  
<210> 729 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GAPDH 
  
<400> 729 
cccggccttc tccatggttt tttctcttgg aaagaaagt 39 
 
 
  
  
<210> 730 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GAPDH 
  
<400> 730 
aacaatctcc actttgccac tgtttttagg cataggaccc gtgtct 46 
 
 
  
  
<210> 731 
<211> 50 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GAPDH 
  
<400> 731 
catgtagacc atgtagttga ggtcaatttt taggcatagg acccgtgtct  50 
 
 
  
  
<210> 732 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GAPDH 
  
<400> 732 
gacaagcttc ccattctcgg tttttaggca taggacccgt gtct 44 
 
 
  
  
<210> 733 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GAPDH 
  
<400> 733 
tgatgggctt cccgttgatt ttttaggcat aggacccgtg tct 43 
 
 
  
  
<210> 734 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GAPDH 
  
<400> 734 
gacatactca gcaccggcct tttttaggca taggacccgt gtct 44 
 
 
  
  
<210> 735 
<211> 19 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GAPDH 
  
<400> 735 
tgaaggggtc gttgatggc 19 
 
 
  
  
<210> 736 
<211> 23 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GAPDH 
  
<400> 736 
ccgtgagtgg agtcatactg gaa 23 
 
 
  
  
<210> 737 
<211> 22 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GAPDH 
  
<400> 737 
caccccattt gatgttagtg gg 22 
 
 
  
  
<210> 738 
<211> 24 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for mouse GAPDH 
  
<400> 738 
ggtgaagaca ccagtagact ccac 24 
 
 
  
<210> 739 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 10, 11 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 739 
uggucgaaca guuuuuucut t 21 
 
 
<210> 740 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 10, 11 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 740 
uggucgaaca guuuuuucct t 21 
 
 
<210> 741 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 10, 11 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 741 
uggucgaaca guuuuuucct t 21 
 
 
<210> 742 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 10, 11, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 742 
uggucgaaca guuuuuucgt t 21 
 
 
<210> 743 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 10, 11, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 743 
uggucgaaca guuuuuucgt t 21 
 
 
<210> 744 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 744 
agaaaaaacu guucgaccat t 21 
 
 
<210> 745 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 745 
agaaaaaacu guucgaccat t 21 
 
 
<210> 746 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' inverted desoxythymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 10, 11 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 746 
uggucgaaca guuuuuucut  20 
 
 
<210> 747 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' inverted desoxythymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 10, 11 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 747 
uggucgaaca guuuuuucut  20 
 
 
<210> 748 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' inverted desoxythymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 10, 11 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 748 
uggucgaaca guuuuuucct  20 
 
 
<210> 749 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' inverted desoxythymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 10, 11 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 749 
uggucgaaca guuuuuucct  20 
 
 
<210> 750 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' inverted desoxythymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 10, 11, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 750 
uggucgaaca guuuuuucgt  20 
 
 
<210> 751 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' inverted desoxythymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 10, 11, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 751 
uggucgaaca guuuuuucgt  20 
 
 
<210> 752 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' inverted desoxythymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 752 
agaaaaaacu guucgaccat  20 
 
 
<210> 753 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' inverted desoxythymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 753 
agaaaaaacu guucgaccat  20 
 
 
<210> 754 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' abasic nucleotide" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 10, 11 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 754 
uggucgaaca guuuuuucut  20 
 
 
<210> 755 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' abasic nucleotide" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 10, 11 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 755 
uggucgaaca guuuuuucut  20 
 
 
<210> 756 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' abasic nucleotide" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 10, 11 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 756 
uggucgaaca guuuuuucct  20 
 
 
<210> 757 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' abasic nucleotide" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 10, 11 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 757 
uggucgaaca guuuuuucct  20 
 
 
<210> 758 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' abasic nucleotide" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 10, 11, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 758 
uggucgaaca guuuuuucgt  20 
 
 
<210> 759 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 9, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' abasic nucleotide" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 10, 11, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 759 
uggucgaaca guuuuuucgt  20 
 
 
<210> 760 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' abasic nucleotide" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 760 
agaaaaaacu guucgaccat  20 
 
 
<210> 761 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' abasic nucleotide" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 761 
agaaaaaacu guucgaccat  20 
 
 
<210> 762 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 9, 10, 11, 14, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 8, 12, 13, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 762 
guuccagacu caacuuggct t 21 
 
 
<210> 763 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 9, 10, 11, 14, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 8, 12, 13, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 763 
guuccagacu caacuuggut t 21 
 
 
<210> 764 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 9, 10, 11, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' inverted desoxythymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 8, 12, 13, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 764 
guuccagacu caacuuggat  20 
 
 
<210> 765 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 9, 10, 11, 14, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' inverted desoxythymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 8, 12, 13, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 765 
guuccagacu caacuuggct  20 
 
 
<210> 766 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 9, 10, 11, 14, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' inverted desoxythymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 8, 12, 13, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 766 
guuccagacu caacuuggut  20 
 
 
<210> 767 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 9, 10, 11, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' abasic nucleotide" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 8, 12, 13, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 767 
guuccagacu caacuuggat  20 
 
 
<210> 768 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 9, 10, 11, 14, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' abasic nucleotide" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 8, 12, 13, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 768 
guuccagacu caacuuggct  20 
 
 
<210> 769 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 9, 10, 11, 14, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' abasic nucleotide" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 8, 12, 13, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 769 
guuccagacu caacuuggut  20 
 
 
<210> 770 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 770 
uccaaguuga gucuggaact t 21 
 
 
<210> 771 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' inverted desoxythymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 771 
uccaaguuga gucuggaact  20 
 
 
<210> 772 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' inverted desoxythymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 772 
uccaaguuga gucuggaact  20 
 
 
<210> 773 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' abasic nucleotide" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 773 
uccaaguuga gucuggaact  20 
 
 
<210> 774 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 20 
<223> /mod_base = "thymidine with 3' abasic nucleotide" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 774 
uccaaguuga gucuggaact  20 
 
 

<210> 775 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 775 
ugcaaaccuc aauaggucg 19 
 
 
<210> 776 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 776 
cgaccuauug agguuugca 19 
 
 
<210> 777 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 777 
aaaccucaau aggucgacc 19 
 
 
<210> 778 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 778 
ggucgaccua uugagguuu 19 
 
 
<210> 779 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 779 
aaccucaaua ggucgacca 19 
 
 
<210> 780 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 780 
uggucgaccu auugagguu 19 
 
 
<210> 781 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 781 
accucaauag gucgaccag 19 
 
 
<210> 782 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 782 
cuggucgacc uauugaggu 19 
 
 
<210> 783 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 783 
uuaaugucau uccaccaau 19 
 
 
<210> 784 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 784 
auugguggaa ugacauuaa 19 
 
 
<210> 785 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 785 
ugugauggac uucuauaaa 19 
 
 
<210> 786 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 786 
uuuauagaag uccaucaca 19 
 
 
<210> 787 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 787 
ccaagcagcg aagacuuuu 19 
 
 
<210> 788 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 788 
aaaagucuuc gcugcuugg 19 
 
 
<210> 789 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 789 
uuuccaaaag gcucaguaa 19 
 
 
<210> 790 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 790 
uuacugagcc uuuuggaaa 19 
 
 
<210> 791 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 791 
aaggcucagu aagcaaugc 19 
 
 
<210> 792 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 792 
gcauugcuua cugagccuu 19 
 
 
<210> 793 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 793 
ggcucaguaa gcaaugcgc 19 
 
 
<210> 794 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 794 
gcgcauugcu uacugagcc 19 
 
 
<210> 795 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 795 
cucaguaagc aaugcgcag 19 
 
 
<210> 796 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 796 
cugcgcauug cuuacugag 19 
 
 
<210> 797 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 797 
cucucaaugg gacuguaua 19 
 
 
<210> 798 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 798 
uauacagucc cauugagag 19 
 
 
<210> 799 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 799 
ucucaauggg acuguauau 19 
 
 
<210> 800 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 800 
auauacaguc ccauugaga 19 
 
 
<210> 801 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 801 
ucaaugggac uguauaugg 19 
 
 
<210> 802 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 802 
ccauauacag ucccauuga 19 
 
 
<210> 803 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 803 
ugggaaauga ccugggauu 19 
 
 
<210> 804 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 804 
aaucccaggu cauuuccca 19 
 
 
<210> 805 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 805 
agcauugcaa accucaaua 19 
 
 
<210> 806 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 806 
uauugagguu ugcaaugcu 19 
 
 
<210> 807 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 807 
uuugacauuu ugcaggauu 19 
 
 
<210> 808 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 808 
aauccugcaa aaugucaaa 19 
 
 
<210> 809 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 809 
cccagguaaa gagacgaau 19 
 
 
<210> 810 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 810 
auucgucucu uuaccuggg 19 
 
 
<210> 811 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 811 
ccagguaaag agacgaaug 19 
 
 
<210> 812 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 812 
cauucgucuc uuuaccugg 19 
 
 
<210> 813 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 813 
cagguaaaga gacgaauga 19 
 
 
<210> 814 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 814 
ucauucgucu cuuuaccug 19 
 
 
<210> 815 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 815 
agacgaauga gaguccuug 19 
 
 
<210> 816 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 816 
caaggacucu cauucgucu 19 
 
 
<210> 817 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 817 
agaucagacc uguugauag 19 
 
 
<210> 818 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 818 
cuaucaacag gucugaucu 19 
 
 
<210> 819 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 819 
ucagaccugu ugauagaug 19 
 
 
<210> 820 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 820 
caucuaucaa caggucuga 19 
 
 
<210> 821 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 821 
acgauucauu ccuuuugga 19 
 
 
<210> 822 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 822 
uccaaaagga augaaucgu 19 
 
 
<210> 823 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 823 
aagccucuca uuuuaccgg 19 
 
 
<210> 824 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 824 
ccgguaaaau gagaggcuu 19 
 
 
<210> 825 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 825 
agccucucau uuuaccgga 19 
 
 
<210> 826 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 826 
uccgguaaaa ugagaggcu 19 
 
 
<210> 827 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 827 
gccucucauu uuaccggac 19 
 
 
<210> 828 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 828 
guccgguaaa augagaggc 19 
 
 
<210> 829 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 829 
ccucucauuu uaccggaca 19 
 
 
<210> 830 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 830 
uguccgguaa aaugagagg 19 
 
 
<210> 831 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 831 
ucauuuuacc ggacacuaa 19 
 
 
<210> 832 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 832 
uuaguguccg guaaaauga 19 
 
 
<210> 833 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 833 
uuuuaccgga cacuaaacc 19 
 
 
<210> 834 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 834 
gguuuagugu ccgguaaaa 19 
 
 
<210> 835 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 835 
uuuaccggac acuaaaccc 19 
 
 
<210> 836 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 836 
ggguuuagug uccgguaaa 19 
 
 
<210> 837 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 837 
uuaccggaca cuaaaccca 19 
 
 
<210> 838 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 838 
uggguuuagu guccgguaa 19 
 
 
<210> 839 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 839 
uaccggacac uaaacccaa 19 
 
 
<210> 840 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 840 
uuggguuuag uguccggua 19 
 
 
<210> 841 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 841 
aucugguuuu gucaagccc 19 
 
 
<210> 842 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 842 
gggcuugaca aaaccagau 19 
 
 
<210> 843 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 843 
aaaaagaaga uuucaucga 19 
 
 
<210> 844 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 844 
ucgaugaaau cuucuuuuu 19 
 
 
<210> 845 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 845 
agaagauuuc aucgaacuc 19 
 
 
<210> 846 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 846 
gaguucgaug aaaucuucu 19 
 
 
<210> 847 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 847 
aaacugggca caguuuacu 19 
 
 
<210> 848 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 848 
aguaaacugu gcccaguuu 19 
 
 
<210> 849 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 849 
uucuguucau ggugugagu 19 
 
 
<210> 850 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 850 
acucacacca ugaacagaa 19 
 
 
<210> 851 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 851 
guucauggug ugaguaccu 19 
 
 
<210> 852 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 852 
agguacucac accaugaac 19 
 
 
<210> 853 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 853 
ggaggacaga uguaccacu 19 
 
 
<210> 854 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 854 
agugguacau cuguccucc 19 
 
 
<210> 855 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 855 
cagcaucccu uucucaaca 19 
 
 
<210> 856 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 856 
uguugagaaa gggaugcug 19 
 
 
<210> 857 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 857 
aggaucagaa gccuauuuu 19 
 
 
<210> 858 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 858 
aaaauaggcu ucugauccu 19 
 
 
<210> 859 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 859 
auuccaccaa uucccguug 19 
 
 
<210> 860 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 860 
caacgggaau ugguggaau 19 
 
 
<210> 861 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 861 
uuccaccaau ucccguugg 19 
 
 
<210> 862 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 862 
ccaacgggaa uugguggaa 19 
 
 
<210> 863 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 863 
uccaccaauu cccguuggu 19 
 
 
<210> 864 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 864 
accaacggga auuggugga 19 
 
 
<210> 865 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 865 
ccaccaauuc ccguugguu 19 
 
 
<210> 866 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 866 
aaccaacggg aauuggugg 19 
 
 
<210> 867 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 867 
caccaauucc cguugguuc 19 
 
 
<210> 868 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 868 
gaaccaacgg gaauuggug 19 
 
 
<210> 869 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 869 
cucugaacuu cccuggucg 19 
 
 
<210> 870 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 870 
cgaccaggga aguucagag 19 
 
 
<210> 871 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 871 
acuucccugg ucgaacagu 19 
 
 
<210> 872 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 872 
acuguucgac cagggaagu 19 
 
 
<210> 873 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 873 
uggucgaaca guuuuuucu 19 
 
 
<210> 874 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 874 
agaaaaaacu guucgacca 19 
 
 
<210> 875 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 875 
uuucuaaugg cuauucaag 19 
 
 
<210> 876 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 876 
cuugaauagc cauuagaaa 19 
 
 
<210> 877 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 877 
augagaccag auguaagcu 19 
 
 
<210> 878 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 878 
agcuuacauc uggucucau 19 
 
 
<210> 879 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 879 
ccagauguaa gcucuccuc 19 
 
 
<210> 880 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 880 
gaggagagcu uacaucugg 19 
 
 
<210> 881 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 881 
cuggugugcu cugaugaag 19 
 
 
<210> 882 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 882 
cuucaucaga gcacaccag 19 
 
 
<210> 883 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 883 
gucuuaacuu guggaagcu 19 
 
 
<210> 884 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 884 
agcuuccaca aguuaagac 19 
 
 
<210> 885 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 885 
caucaucgau aaaauucga 19 
 
 
<210> 886 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 886 
ucgaauuuua ucgaugaug 19 
 
 
<210> 887 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 887 
cccagcaugc cgcuaucga 19 
 
 
<210> 888 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 888 
ucgauagcgg caugcuggg 19 
 
 
<210> 889 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 889 
ccagcaugcc gcuaucgaa 19 
 
 
<210> 890 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 890 
uucgauagcg gcaugcugg 19 
 
 
<210> 891 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 891 
cagcaugccg cuaucgaaa 19 
 
 
<210> 892 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 892 
uuucgauagc ggcaugcug 19 
 
 
<210> 893 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 893 
agcaugccgc uaucgaaaa 19 
 
 
<210> 894 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 894 
uuuucgauag cggcaugcu 19 
 
 
<210> 895 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 895 
augccgcuau cgaaaaugu 19 
 
 
<210> 896 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 896 
acauuuucga uagcggcau 19 
 
 
<210> 897 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 897 
ccgcuaucga aaaugucuu 19 
 
 
<210> 898 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 898 
aagacauuuu cgauagcgg 19 
 
 
<210> 899 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 899 
cgcuaucgaa aaugucuuc 19 
 
 
<210> 900 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 900 
gaagacauuu ucgauagcg 19 
 
 
<210> 901 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 901 
aggaauucag caggccacu 19 
 
 
<210> 902 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 902 
aguggccugc ugaauuccu 19 
 
 
<210> 903 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 903 
auucagcagg ccacuacag 19 
 
 
<210> 904 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 904 
cuguaguggc cugcugaau 19 
 
 
<210> 905 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 905 
cuacaggagu cucacaaga 19 
 
 
<210> 906 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 906 
ucuugugaga cuccuguag 19 
 
 
<210> 907 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 907 
aaaacaauag uuccugcaa 19 
 
 
<210> 908 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 908 
uugcaggaac uauuguuuu 19 
 
 
<210> 909 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 909 
aaacaauagu uccugcaac 19 
 
 
<210> 910 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 910 
guugcaggaa cuauuguuu 19 
 
 
<210> 911 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 911 
aacaauaguu ccugcaacg 19 
 
 
<210> 912 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 912 
cguugcagga acuauuguu 19 
 
 
<210> 913 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 913 
acaauaguuc cugcaacgu 19 
 
 
<210> 914 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 914 
acguugcagg aacuauugu 19 
 
 
<210> 915 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 915 
auaguuccug caacguuac 19 
 
 
<210> 916 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 916 
guaacguugc aggaacuau 19 
 
 
<210> 917 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 917 
uaguuccugc aacguuacc 19 
 
 
<210> 918 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 918 
gguaacguug caggaacua 19 
 
 
<210> 919 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 919 
cugcaacguu accacaacu 19 
 
 
<210> 920 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 920 
aguuguggua acguugcag 19 
 
 
<210> 921 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 921 
ugcaacguua ccacaacuc 19 
 
 
<210> 922 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 922 
gaguuguggu aacguugca 19 
 
 
<210> 923 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 923 
ugaaccugaa guguuauau 19 
 
 
<210> 924 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 924 
auauaacacu ucagguuca 19 
 
 
<210> 925 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 925 
uguuauaugc aggauauga 19 
 
 
<210> 926 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 926 
ucauauccug cauauaaca 19 
 
 
<210> 927 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 927 
gcucuguucc agacucaac 19 
 
 
<210> 928 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 928 
guugagucug gaacagagc 19 
 
 
<210> 929 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 929 
guuccagacu caacuugga 19 
 
 
<210> 930 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 930 
uccaaguuga gucuggaac 19 
 
 
<210> 931 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 931 
cucaacuugg aggaucaug 19 
 
 
<210> 932 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 932 
caugauccuc caaguugag 19 
 
 
<210> 933 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 933 
acgcucaaca uguuaggag 19 
 
 
<210> 934 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 934 
cuccuaacau guugagcgu 19 
 
 
<210> 935 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 935 
gggcggcaag ugauugcag 19 
 
 
<210> 936 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 936 
cugcaaucac uugccgccc 19 
 
 
<210> 937 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 937 
cagguuucag gaacuuaca 19 
 
 
<210> 938 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 938 
uguaaguucc ugaaaccug 19 
 
 
<210> 939 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 939 
gguuucagga acuuacacc 19 
 
 
<210> 940 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 940 
gguguaaguu ccugaaacc 19 
 
 
<210> 941 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 941 
aacuuacacc uggaugacc 19 
 
 
<210> 942 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 942 
ggucauccag guguaaguu 19 
 
 
<210> 943 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 943 
acuuacaccu ggaugacca 19 
 
 
<210> 944 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 944 
uggucaucca gguguaagu 19 
 
 
<210> 945 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 945 
ugaccaaaug acccuacug 19 
 
 
<210> 946 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 946 
caguaggguc auuugguca 19 
 
 
<210> 947 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 947 
ggguggagau cauauagac 19 
 
 
<210> 948 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 948 
gucuauauga ucuccaccc 19 
 
 
<210> 949 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 949 
gguggagauc auauagaca 19 
 
 
<210> 950 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 950 
ugucuauaug aucuccacc 19 
 
 
<210> 951 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 951 
gagaucauau agacaauca 19 
 
 
<210> 952 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 952 
ugauugucua uaugaucuc 19 
 
 
<210> 953 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 953 
cauauagaca aucaagugc 19 
 
 
<210> 954 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 954 
gcacuugauu gucuauaug 19 
 
 
<210> 955 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 955 
cauguacgac caauguaaa 19 
 
 
<210> 956 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 956 
uuuacauugg ucguacaug 19 
 
 
<210> 957 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 957 
auguacgacc aauguaaac 19 
 
 
<210> 958 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 958 
guuuacauug gucguacau 19 
 
 
<210> 959 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 959 
uguacgacca auguaaaca 19 
 
 
<210> 960 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 960 
uguuuacauu ggucguaca 19 
 
 
<210> 961 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 961 
caggcuucag guaucuuau 19 
 
 
<210> 962 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 962 
auaagauacc ugaagccug 19 
 
 
<210> 963 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 963 
ucuguaugaa aaccuuacu 19 
 
 
<210> 964 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 964 
aguaagguuu ucauacaga 19 
 
 
<210> 965 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 965 
cuguaugaaa accuuacug 19 
 
 
<210> 966 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 966 
caguaagguu uucauacag 19 
 
 
<210> 967 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 967 
guaugaaaac cuuacugcu 19 
 
 
<210> 968 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 968 
agcaguaagg uuuucauac 19 
 
 
<210> 969 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 969 
gaaauuagaa ugaccuaca 19 
 
 
<210> 970 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 970 
uguaggucau ucuaauuuc 19 
 
 
<210> 971 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 971 
gaacuggcag cgguuuuau 19 
 
 
<210> 972 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 972 
auaaaaccgc ugccaguuc 19 
 
 
<210> 973 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 973 
acuggcagcg guuuuauca 19 
 
 
<210> 974 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 974 
ugauaaaacc gcugccagu 19 
 
 
<210> 975 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 975 
aacucuugga uucuaugca 19 
 
 
<210> 976 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 976 
ugcauagaau ccaagaguu 19 
 
 
<210> 977 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 977 
cacacauuaa ucugauuuu 19 
 
 
<210> 978 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 978 
aaaaucagau uaaugugug 19 
 
 
<210> 979 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 979 
ucccaacaau cuuggcgcu 19 
 
 
<210> 980 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 980 
agcgccaaga uuguuggga 19 
 
 
<210> 981 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 981 
cccaacaauc uuggcgcuc 19 
 
 
<210> 982 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 982 
gagcgccaag auuguuggg 19 
 
 
<210> 983 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 983 
ccaacaaucu uggcgcuca 19 
 
 
<210> 984 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 984 
ugagcgccaa gauuguugg 19 
 
 
<210> 985 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 985 
aacaaucuug gcgcucaaa 19 
 
 
<210> 986 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 986 
uuugagcgcc aagauuguu 19 
 
 
<210> 987 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 987 
uuggcgcuca aaaaauaga 19 
 
 
<210> 988 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 988 
ucuauuuuuu gagcgccaa 19 
 
 
<210> 989 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 989 
uggcgcucaa aaaauagaa 19 
 
 
<210> 990 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 990 
uucuauuuuu ugagcgcca 19 
 
 
<210> 991 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 991 
aggcuuuuca uuaaauggg 19 
 
 
<210> 992 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 992 
cccauuuaau gaaaagccu 19 
 
 
<210> 993 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 993 
uccuauguau guguuaucu 19 
 
 
<210> 994 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 994 
agauaacaca uacauagga 19 
 
 
<210> 995 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 995 
ccuauguaug uguuaucug 19 
 
 
<210> 996 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 996 
cagauaacac auacauagg 19 
 
 
<210> 997 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 997 
cagugagagu ugguuacuc 19 
 
 
<210> 998 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 998 
gaguaaccaa cucucacug 19 
 
 
<210> 999 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 999 
agugagaguu gguuacuca 19 
 
 
<210> 1000 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1000 
ugaguaacca acucucacu 19 
 
 
<210> 1001 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1001 
gugagaguug guuacucac 19 
 
 
<210> 1002 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1002 
gugaguaacc aacucucac 19 
 
 
<210> 1003 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1003 
ugagaguugg uuacucaca 19 
 
 
<210> 1004 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1004 
ugugaguaac caacucuca 19 
 
 
<210> 1005 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1005 
ugguccaccc aggauuagu 19 
 
 
<210> 1006 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1006 
acuaauccug gguggacca 19 
 
 
<210> 1007 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1007 
gguccaccca ggauuagug 19 
 
 
<210> 1008 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1008 
cacuaauccu ggguggacc 19 
 
 
<210> 1009 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1009 
uagugaccag guuuucagg 19 
 
 
<210> 1010 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1010 
ccugaaaacc uggucacua 19 
 
 
<210> 1011 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1011 
ggcuguauga aaauacccu 19 
 
 
<210> 1012 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1012 
aggguauuuu cauacagcc 19 
 
 
<210> 1013 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1013 
cuguaugaaa auacccucc 19 
 
 
<210> 1014 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1014 
ggaggguauu uucauacag 19 
 
 
<210> 1015 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1015 
auacccuccu caaauaacu 19 
 
 
<210> 1016 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1016 
aguuauuuga ggaggguau 19 
 
 
<210> 1017 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1017 
aaauaacuug cuuaacuac 19 
 
 
<210> 1018 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1018 
guaguuaagc aaguuauuu 19 
 
 
<210> 1019 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1019 
aauaacuugc uuaacuaca 19 
 
 
<210> 1020 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1020 
uguaguuaag caaguuauu 19 
 
 
<210> 1021 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1021 
uugcuuaacu acauauaga 19 
 
 
<210> 1022 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1022 
ucuauaugua guuaagcaa 19 
 
 
<210> 1023 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1023 
ugcuuaacua cauauagau 19 
 
 
<210> 1024 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1024 
aucuauaugu aguuaagca 19 
 
 
<210> 1025 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1025 
uaguuuuuua uucaugcug 19 
 
 
<210> 1026 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1026 
cagcaugaau aaaaaacua 19 
 
 
<210> 1027 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1027 
caugcugaau aauaaucug 19 
 
 
<210> 1028 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1028 
cagauuauua uucagcaug 19 
 
 
<210> 1029 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1029 
acuguaaaac cuugugugg 19 
 
 
<210> 1030 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1030 
ccacacaagg uuuuacagu 19 
 
 
<210> 1031 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1031 
ugcuguucug guauuacca 19 
 
 
<210> 1032 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1032 
ugguaauacc agaacagca 19 
 
 

<210> 1033 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1033 
uggucgaaca guuuuuucc 19 
 
 
<210> 1034 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1034 
uggucgaaca guuuuuucg 19 
 
 
<210> 1035 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1035 
guuccagacu caacuuggc 19 
 
 
<210> 1036 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1036 
guuccagacu caacuuggu 19 
 
 


