
Sequence Listing

<110> Governing Council of the University of Toronto

<120> Metal nanoshell-coated barcodes

<140> PCT/CA2014/050108
<141> 2014-02-14 

<150>  US 61/765,366
<151> 2013-02-15

<160> 8

<210> 1
<211> 31
<212> DNA
<213> Artificial sequence

<220>
<223> Oligonucleotide sequence modified with a poly A repeat unit spacer (9 units) at the5 end

<300>
<301> Kun, Chen; Chou, Leo Y.T.; Song,  Fayi ; Chan,  Warren C.W.
<302> Fabrication of metal nanoshell quantum-dot barcodes for biomolecular detection
<303> Nano Today
<304>  8	
<305> 3
<306> 228-234
<307> 2013-06

<400> 1
aaaaaaaaagacaatgctcactgaggatagt 						31
<210> 2
<211> 50
<212> DNA
<213> Artificial sequence 
<220>
<223> Complementary sequence to unmodified hybrid of SEQ ID NO 1 and SEQ ID NO 9
<400> 2
ctgttacgag tgactcctat caatcattca cacgatccat aagtagcggc			50


<210> 3
<211> 24
<212> DNA
<213> Artificial sequence

<220>
<223> Oligonucleotide sequence modified with a poly A repeat unit spacer (9 units) at the 5 end

<400> 3
aaaaaaaaaccaatatcggcggcc							24

<210> 4
<211>  43
<212> DNA
<213> Artificial sequence 
<220>
<223> Complementary sequence to unmodified hybrid of SEQ ID NO 3 and SEQ ID NO 9
<400> 4
ggttatagcc gccggatcat tcacacgatc cataagtagc ggc				43

<210> 5
<211> 39
<212> DNA
<213> Artificial sequence

<220>
<223> Oligonucleotide sequence modified with a poly A repeat unit spacer (9 units) at the 5 end

<400>5
aaaaaaaaaaatatatttggttttcccaaaccagtttaa					39


<210> 6
<211> 58
<212> DNA
<213> Artificial sequence

<220>
<223> Complementary sequence to unmodified hybrid of SEQ ID NO 5 and SEQ ID NO 9

<400> 6
ttatataaac caaaagggtt tggtcaaatt atcattcaca cgatccataa gtagcggc		58


<210> 7
<211> 39
<212> DNA
<213> Artificial sequence

<220>
<223> Oligonucleotide sequence modified with a poly A repeat unit spacer (9 units) at the 5 end

<400> 7
aaaaaaaaag tatcagttat gtggattaag ctagaagcg					39


<210> 8
<211> 58
<212> DNA
<213> Artificial sequence

<220>
<223> Complementary sequence to unmodified hybrid of SEQ ID NO 7 and SEQ ID NO 9

<400> 8
catagtcaat acacctaatt cgatcttcgc atcattcaca cgatccataa gtagcggc		58


<210> 9
<211> 25
<212> DNA
<213> Artificial sequence

<220>
<221> misc_binding
<222>1
<223> Oligonucleotide sequence modified with fluorophore (AF647) at 5 end

<400> 9
 taagtgtgct aggtattcat cgccg						25


<210> 10
<211> 31
<212> DNA
<213> Artificial sequence

<220>
<221>  misc_binding
<222> 1
<223> Oligonucleotide sequence with a dithiol modification at the first base of the 5 end

<400> 10
aaaaaaaaag acaatgctca ctgaggatag t 						31


<210> 11
<211> 24
<212> DNA
<213>Artificial sequence

<220>
<221> misc_binding
<222> 1
<223> Oligonucleotide sequence with a dithiol modification at the first base of the 5 end

<400> 11
aaaaaaaaac caatatcggc ggcc							24


<210> 12
<211> 39
<212> DNA
<213> Artificial sequence

<220>
<221> misc_binding
<222> 1 
<223> Oligonucleotide sequence with a dithiol modification at the first base of the 5 end

<400> 12
aaaaaaaaaa atatatttgg ttttcccaaa ccagtttaa					39


<210> 13
<211> 39
<212> DNA
<213> Artificial sequence

<220>
<221> misc_binding
<222> 1
<223> Oligonucleotide sequence with a dithiol modification at the first base of the 5 end

<400> 13
aaaaaaaaag tatcagttat gtggattaag ctagaagcg					39




1


